| MirGeneDB ID | Dno-Mir-155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-155 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Nine-banded armadillo (Dasypus novemcinctus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dno-mir-155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-155 Ami-Mir-155 Bta-Mir-155 Cfa-Mir-155 Cja-Mir-155 Cli-Mir-155 Cmi-Mir-155 Cpi-Mir-155 Cpo-Mir-155 Dre-Mir-155 Ebu-Mir-155 Eca-Mir-155 Ete-Mir-155 Gga-Mir-155 Gja-Mir-155 Gmo-Mir-155 Hsa-Mir-155 Laf-Mir-155 Lch-Mir-155 Loc-Mir-155 Mal-Mir-155 Mdo-Mir-155 Mml-Mir-155 Mmr-Mir-155 Mmu-Mir-155 Mun-Mir-155 Neu-Mir-155 Oan-Mir-155 Ocu-Mir-155 Pab-Mir-155 Pbv-Mir-155 Pma-Mir-155 Rno-Mir-155 Sha-Mir-155 Spt-Mir-155-P3 Spt-Mir-155-P4 Sto-Mir-155 Tgu-Mir-155 Tni-Mir-155 Xla-Mir-155-P1 Xla-Mir-155-P2 Xtr-Mir-155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (dasNov3) |
JH570026: 4269411-4269471 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UAAUGCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUCUGGAAGCUGACUGUAGGCUGUAUGCUGUUAAUGCUAAUCGUGAUAGGGGUUUUUACCUCCAACUAACUCCUACAUGUUAGCAUUAACAGGGUAUGAUGCCUGUUACUAGCAUUCACAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UUCUGGAAGCUGACUGUA U--| G U A UUUACC GGC GUAU CUGUUAAUGCUAA CGUG UAGGGGUU \ CCG UAUG GACAAUUACGAUU GUAC AUCCUCAA U UACACUUACGAUCAUUGU UAG^ G - - UCAACC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dno-Mir-155_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047687 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUAAUGCUAAUCGUGAUAGGGGUU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dno-Mir-155_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047688 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- CUCCUACAUGUUAGCAUUAACA -61
Get sequence
|






