| MirGeneDB ID | Efe-Mir-29-P1j | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-29 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Common brandling worm (Eisenia fetida) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Efe-Mir-29-P1i Efe-Mir-29-P2k Efe-Mir-29-P2l | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-29-P1 Aga-Mir-29-P1 Agr-Mir-29-P1 Asu-Mir-29-P1 Bfl-Mir-29-P1 Bla-Mir-29-P1 Cbr-Mir-29-P1 Cel-Mir-29-P1 Cin-Mir-29-o1 Csc-Mir-29-P1 Cte-Mir-29-P1 Dan-Mir-29-P1 Dgr-Mir-29-P1 Dlo-Mir-29-P1 Dma-Mir-29-P1 Dme-Mir-29-P1 Dmo-Mir-29-P1 Dpu-Mir-29-P1 Dsi-Mir-29-P1 Dya-Mir-29-P1 Eba-Mir-29-P1 Esc-Mir-29-P1 Gpa-Mir-29-P1 Gsp-Mir-29 Hme-Mir-29-P1 Hru-Mir-29-P1 Isc-Mir-29-P1 Lhy-Mir-29-P1 Llo-Mir-29-P1 Mgi-Mir-29-P1 Mom-Mir-29-P1 Npo-Mir-29-P1 Obi-Mir-29-P1 Ofu-Mir-29-P1 Ovu-Mir-29-P1 Pau-Mir-29-P1 Pcr-Mir-29-P1 Pdu-Mir-29-P1 Pfl-Mir-29-P1 Pmi-Mir-29-P1 Pve-Mir-29-P1 Rph-Mir-29-P1 Sko-Mir-29-P1 Snu-Mir-29-P1 Spu-Mir-29-P1 Tca-Mir-29-P1 Tur-Mir-29-P1 War-Mir-29-P1 Xbo-Mir-29-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | E. fetida | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Efe_combined) |
Efet.01.454037: 307-366 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCACCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUGGAGGAUUGGUUUAAUCUUCUGGAAACCUGCUUUCCUCUGGUGACUGGAUUAGAACGACUUUUUCUAGCACCAGUUGAAAUCAGCUUUCCCGUCGAUCUAAAAUCGGCUACAUUAGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUGGAGGAUUGGUUUA---| UUCU C C CU A UUAGAA AUC GGAAA CUG UUUC CUGGUG CUGGA C UAG CCUUU GAC AAAG GACCAC GAUCU G GGAUUACAUCGGCUAAAAUC^ CUGC C U UU - UUUUCA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Efe-Mir-29-P1j_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUGCUUUCCUCUGGUGACUGGA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Efe-Mir-29-P1j_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAGCACCAGUUGAAAUCAGCUU -60
Get sequence
|






