| MirGeneDB ID | Mun-Mir-103-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-103 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Microcaecilia (Microcaecilia unicolor) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mun-Mir-103-P1 Mun-Mir-103-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-103-P4 Ami-Mir-103-P4 Bta-Mir-103-P4 Cfa-Mir-103-P4 Cja-Mir-103-P4 Cli-Mir-103-P4 Cmi-Mir-103-P4 Cpi-Mir-103-P4 Cpo-Mir-103-P4 Dno-Mir-103-P4 Eca-Mir-103-P4 Ete-Mir-103-P4 Gga-Mir-103-P4 Gja-Mir-103-P4 Hmi-Mir-103 Hsa-Mir-103-P4 Laf-Mir-103-P4 Lch-Mir-103-P4 Loc-Mir-103-P4 Mdo-Mir-103-P4 Mml-Mir-103-P4 Mmr-Mir-103-P4 Mmu-Mir-103-P4 Neu-Mir-103-P4 Oan-Mir-103-P4 Ocu-Mir-103-P4 Pab-Mir-103-P4 Pbv-Mir-103-P4 Pfl-Mir-103 Pmi-Mir-103 Rno-Mir-103-P4 Sha-Mir-103-P4 Sko-Mir-103 Spt-Mir-103-P4 Spu-Mir-103 Sro-Mir-103 Sto-Mir-103-P4 Tgu-Mir-103-P4 Xbo-Mir-103 Xla-Mir-103-P4 Xtr-Mir-103-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_901765095.2_aMicUni1.2) |
LR594636.1: 83663142-83663201 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GCAGCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUUGCAGGAUUCACAUUCUCUCUGCUUUCAGCUUCUUUACAGUGUUGGGUUGUGGCAUGGAAUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACUGAGAACUGCUUCGCAAGGUCUUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUUGCAGGAUUCACAU-- UC C--| U U GG UGGCA UCUC UGCUUU AGCU CU UACAGUGUUG UUG U AGAG ACGAAA UCGG GA AUGUUACGAC AAC G GUUCUGGAACGCUUCGUCA UC CUA^ - C G- UUAAG . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mun-Mir-103-P4_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGCUUCUUUACAGUGUUGGGUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mun-Mir-103-P4_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AGCAGCAUUGUACAGGGCUAUCA -60
Get sequence
|






