| MirGeneDB ID | Pbv-Mir-103-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-103 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-103-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-103-P1 Pbv-Mir-103-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-103-P2 Ami-Mir-103-P2 Bta-Mir-103-P2 Cfa-Mir-103-P2 Cja-Mir-103-P2 Cli-Mir-103-P2 Cmi-Mir-103-P2 Cpi-Mir-103-P2 Cpo-Mir-103-P2 Dno-Mir-103-P2 Dre-Mir-103-P2a Dre-Mir-103-P2b Eca-Mir-103-P2 Ete-Mir-103-P2 Gga-Mir-103-P2 Gja-Mir-103-P2 Gmo-Mir-103-P2a Gmo-Mir-103-P2b Hmi-Mir-103 Hsa-Mir-103-P2 Laf-Mir-103-P2 Lch-Mir-103-P2 Loc-Mir-103-P2 Mal-Mir-103-P2a Mal-Mir-103-P2b Mdo-Mir-103-P2 Mml-Mir-103-P2 Mmr-Mir-103-P2 Mmu-Mir-103-P2 Mun-Mir-103-P2 Neu-Mir-103-P2 Oan-Mir-103-P2 Ocu-Mir-103-P2 Pab-Mir-103-P2 Pfl-Mir-103 Pma-Mir-103-o2 Pmi-Mir-103 Rno-Mir-103-P2 Sha-Mir-103-P2 Sko-Mir-103 Spt-Mir-103-P2 Spu-Mir-103 Sro-Mir-103 Sto-Mir-103-P2 Tgu-Mir-103-P2 Tni-Mir-103-P2a Tni-Mir-103-P2b Xbo-Mir-103 Xla-Mir-103-P2c Xla-Mir-103-P2d Xtr-Mir-103-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE957747.1: 64005-64064 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GCAGCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGCAUCAUGGGAAUUAAGCUGGGCGCUUCCAGCUUCUUUACAGUGCUGCCUUGUUGCAACCAUGUCAAGCAGCAUUGUACAGGGCUAUGAAAGAACCCAAGCGUGGCGUCGGCUUGCGGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGCAUCAUGGGAAUUAA- - CG C --| U U C UUGCA GC UGGG CUU C AGCU CU UACAGUGCUGC UUG A CG ACCC GAA G UCGG GA AUGUUACGACG AAC C UGGCGUUCGGCUGCGGUG A AA A UA^ - C - UGUAC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-103-P2_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGCUUCUUUACAGUGCUGCCUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-103-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038904 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AGCAGCAUUGUACAGGGCUAUGA -60
Get sequence
|
