| MirGeneDB ID | Pbv-Mir-205-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-205 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-205a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-205-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-205-P4 Ami-Mir-205-P4 Bta-Mir-205-P4 Cfa-Mir-205-P4 Cja-Mir-205-P4 Cli-Mir-205-P4 Cmi-Mir-205-P4 Cpi-Mir-205-P4 Cpo-Mir-205-P4 Dno-Mir-205-P4 Dre-Mir-205-P4a Eca-Mir-205-P4 Ete-Mir-205-P4 Gga-Mir-205-P4 Gja-Mir-205-P4 Gmo-Mir-205-P4a Gmo-Mir-205-P4b Hsa-Mir-205-P4 Laf-Mir-205-P4 Lch-Mir-205-P4 Loc-Mir-205-P4 Loc-Mir-205-P4-as Mal-Mir-205-P4a Mal-Mir-205-P4b Mdo-Mir-205-P4 Mml-Mir-205-P4 Mmr-Mir-205-P4 Mmu-Mir-205-P4 Mun-Mir-205-P4 Neu-Mir-205-P4 Oan-Mir-205-P4 Ocu-Mir-205-P4 Pab-Mir-205-P4 Rno-Mir-205-P4 Sha-Mir-205-P4 Spt-Mir-205-P4 Sto-Mir-205-P4 Tgu-Mir-205-P4 Tni-Mir-205-P4a Xla-Mir-205-P4c Xla-Mir-205-P4d Xtr-Mir-205-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE958769.1: 21176-21234 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CCUUCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CACUUAAAGAAUGUUCCAUGCAUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCGAAUACCUAAUCAGAUUUCAGUGGCGUGAAGUACAUGAGACAUGGAGUUGAAUCAGCUGAGCCUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CACUUAAAGAAUGUUCCAUG- -| GU C U C UCGAAU CAU UCU UGU CUUCAU CCAC GGAGUCUG \ GUA AGA ACA GAAGUG GGUG CUUUAGAC A UUCCGAGUCGACUAAGUUGAG C^ GU U C A UAAUCC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut +1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-205-P4_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039009 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-205-P4_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- GAUUUCAGUGGCGUGAAGUACA -59
Get sequence
|






