| MirGeneDB ID | Sto-Mir-204-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-204 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-204-P2 Sto-Mir-204-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-204-P1 Ami-Mir-204-P1 Bta-Mir-204-P1 Cfa-Mir-204-P1 Cja-Mir-204-P1 Cli-Mir-204-P1 Cmi-Mir-204-P1 Cpi-Mir-204-P1 Cpo-Mir-204-P1 Dno-Mir-204-P1 Dre-Mir-204-P1a Dre-Mir-204-P1b Ebu-Mir-204 Eca-Mir-204-P1 Gga-Mir-204-P1 Gja-Mir-204-P1 Gmo-Mir-204-P1a Gmo-Mir-204-P1b Hsa-Mir-204-P1 Laf-Mir-204-P1 Lch-Mir-204-P1 Loc-Mir-204-P1 Mal-Mir-204-P1a Mdo-Mir-204-P1 Mml-Mir-204-P1 Mmr-Mir-204-P1 Mmu-Mir-204-P1 Mun-Mir-204-P1 Neu-Mir-204-P1 Oan-Mir-204-P1 Ocu-Mir-204-P1 Pab-Mir-204-P1 Pbv-Mir-204-P1 Pma-Mir-204 Rno-Mir-204-P1 Sha-Mir-204-P1 Spt-Mir-204-P1 Tgu-Mir-204-P1 Tni-Mir-204-P1a Xla-Mir-204-P1c Xla-Mir-204-P1d Xtr-Mir-204-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01322934.1: 406-463 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCCCUUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CACGUCAGAGAGACGCUGUGACCAGUGGGUUUCCCUUUCUCAUCCUAUGCCUGGGAAUAUUGAUAAGGCAGGGAGGAUAAAGGAUCACUCAACUGUCGAAUUCACUCCCUCCUCACCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CACGUCAGAGAGACGCUG--| C - UUC C A A GGGAAU UGAC AGU GGGU CCUUU UC UCCU UGCCU \ GCUG UCA CUCA GGAAA AG AGGG ACGGA A UCCACUCCUCCCUCACUUAA^ - A CUA U G - AUAGUU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-204-P1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUCCCUUUCUCAUCCUAUGCCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-204-P1_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- GCAGGGAGGAUAAAGGAUCAC -58
Get sequence
|






