| MirGeneDB ID | War-Mir-10-P2s | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-10 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Wirenia (Solenogaster) (Wirenia argentea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | War-Mir-10-P1 War-Mir-10-P2t War-Mir-10-P3 War-Mir-10-P5 War-Mir-10-P6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-10-P2 Adi-Mir-10 Aga-Mir-10-P2 Agr-Mir-10-P2 Asp-Mir-10 Bfl-Mir-10-P2-v1 Bge-Mir-10-P2 Bko-Mir-10-P2 Bla-Mir-10-P2-v1 Bpl-Mir-10-P2 Cbr-Mir-10-P2 Cel-Mir-10-P2 Cin-Mir-10-P2 Cte-Mir-10-P2 Dan-Mir-10-P2 Dgr-Mir-10-P2 Dlo-Mir-10-P2 Dma-Mir-10-P2 Dme-Mir-10-P2 Dmo-Mir-10-P2 Dpu-Mir-10-P2 Dsi-Mir-10-P2 Dya-Mir-10-P2 Eba-Mir-10-P2 Gpa-Mir-10-P2 Gsp-Mir-10-P2 Hru-Mir-10-P2 Isc-Mir-10-P2 Lan-Mir-10-P2 Lgi-Mir-10-P2 Lhy-Mir-10-P2 Llo-Mir-10-P2 Mgi-Mir-10-P2 Mom-Mir-10-P2 Npo-Mir-10-P2 Nve-Mir-10 Obi-Mir-10-P2 Ofu-Mir-10-P2 Ovu-Mir-10-P2 Pau-Mir-10-P2 Pca-Mir-10-P2 Pdu-Mir-10-P2 Pfl-Mir-10-P2 Ple-Mir-10-P2 Pmi-Mir-10-P2 Pve-Mir-10-P2 Rph-Mir-10-P2 Sko-Mir-10-P2 Snu-Mir-10-P2 Tca-Mir-10-P2 Tur-Mir-10-P2 Xbo-Mir-10-P2 Xbo-Mir-10-P2-as | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eumetazoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_025802215.1_ASM2580221v1_Wirenia) |
WNLI01223156.1: 390-445 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | ACCCGUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAGAAAACACGAAAAAUGCCCUCAGCCUCGAACCCGUAGAUCCGAACUUGUGUUGAUUGCGUCACAGGUUCCCAUCUGCGAGUCUGUGGAUGUGCGGCUCAUUCAUCAACAUGGAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAGAAAACACGAAAAAU- CU-| G U A C CC UUGA GCC CA CC CG AC CGUAGAU GAACUUGUG U CGG GU GG GU UG GCGUCUA CUUGGACAC U GAGGUACAACUACUUACU CGU^ A U C A CC UGCG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | War-Mir-10-P2s_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AACCCGUAGAUCCGAACUUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | War-Mir-10-P2s_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- CAGGUUCCCAUCUGCGAGUCUG -56
Get sequence
|






