| MirGeneDB ID | Agr-Mir-2-o85 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | West Indian fuzzy chiton (Acanthopleura granulata ) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Agr-Mir-2-o86a-v1 Agr-Mir-2-o86b Agr-Mir-2-o87-v1 Agr-Mir-2-P12a Agr-Mir-2-P12b Agr-Mir-2-P12c Agr-Mir-2-P12d Agr-Mir-2-P12e Agr-Mir-2-P12f1 Agr-Mir-2-P12f2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Mom-Mir-2-o85-v1 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Polyplacophora | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_016165875.1_ASM1616587v1_Acanthopleura_granulata) |
JABBOT010000080.1: 1397135-1397194 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o85) |
Mir-71
JABBOT010000080.1: 1396833-1396892 [+]
Ensembl
Mir-2-o85 JABBOT010000080.1: 1397135-1397194 [+] Ensembl Mir-2-P12a JABBOT010000080.1: 1397499-1397554 [+] Ensembl Mir-2-o86a-v1 JABBOT010000080.1: 1400008-1400066 [+] Ensembl Mir-2-o86a-v2 JABBOT010000080.1: 1400008-1400066 [+] Ensembl Mir-2-o87-v1 JABBOT010000080.1: 1400233-1400291 [+] Ensembl Mir-2-o87-v2 JABBOT010000080.1: 1400233-1400291 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCGGAGAAGGUAGCUUGUGAACGUCGUGGACGUCAAUGCUGGCAUGUAGUAGCCGGCUCGUUAGCUCUAUCACAGCCAGCUUUGAUGAGCCAGGACCUUCAGUUUUCAGCUUUCAUUACAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCGGAGAAGGUAGCUUG-- C G A-| U A A AGCCGGCU UGAA GUC UGG CGUCAA GCUGGC UGU GU C ACUU CAG ACC GUAGUU CGACCG ACA UA G ACAUUACUUUCGACUUUUG C G GA^ U - C UCUCGAUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Agr-Mir-2-o85_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGUCAAUGCUGGCAUGUAGU -20
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Agr-Mir-2-o85_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUCACAGCCAGCUUUGAUGAGC -60
Get sequence
|






