| MirGeneDB ID | Bla-Mir-22-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-22 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | European lancelet (Branchiostoma lanceolatum) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bla-Mir-22-o3a1a Bla-Mir-22-o3a1b Bla-Mir-22-o3a1c Bla-Mir-22-o3a1d Bla-Mir-22-o3a2a Bla-Mir-22-o3a2b Bla-Mir-22-o3a3 Bla-Mir-22-o3b1 Bla-Mir-22-o3b2 Bla-Mir-22-o3b3 Bla-Mir-22-o3c1 Bla-Mir-22-o3c2 Bla-Mir-22-P1 Bla-Mir-22-P2a Bla-Mir-22-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-22-P2 Aga-Mir-22-P2 Agr-Mir-22-P2 Asu-Mir-22-P2 Bfl-Mir-22-P2b Bge-Mir-22-P2 Cbr-Mir-22-P2-v1 Cel-Mir-22-P2 Csc-Mir-22-P2 Cte-Mir-22-P2 Dan-Mir-22-P2 Dlo-Mir-22-P2 Dma-Mir-22-P2 Dme-Mir-22-P2 Dmo-Mir-22-P2 Dpu-Mir-22-P2 Dsi-Mir-22-P2 Dya-Mir-22-P2 Eba-Mir-22-P2 Esc-Mir-22-P2 Gpa-Mir-22-P2 Hme-Mir-22-P2 Hru-Mir-22-P2 Isc-Mir-22-P2 Lan-Mir-22-P2 Lgi-Mir-22-P2 Lhy-Mir-22-P2 Llo-Mir-22-P2 Mgi-Mir-22-P2 Mom-Mir-22-P2 Npo-Mir-22-P2 Ovu-Mir-22-P2 Pau-Mir-22-P2 Pca-Mir-22-P2 Pdu-Mir-22-P2 Pfl-Mir-22-P2 Pmi-Mir-22-P2 Pve-Mir-22-P2 Rph-Mir-22-P2 Sko-Mir-22-P2 Snu-Mir-22-P2 Spu-Mir-22-P2 Tca-Mir-22-P2-v1 Tur-Mir-22-P2 War-Mir-22-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (BraLan2) |
Sc0000017: 1346304-1346363 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-22-P2b) |
Mir-184
Sc0000017: 1306129-1306193 [+]
Ensembl
Mir-22-P2b Sc0000017: 1346304-1346363 [-] Ensembl Mir-22-P2a Sc0000017: 1361498-1361557 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGCUCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUUUUCUGUAUCGUAAGCGUGUCAGCUUCCCUCAUCACACCGGAAGCUGUUACGUCACUUCCGUUGUAUCAGCUCCAGCUGUGAUGAGUGAAGAGGCAUGCGCAGAACAACAAACCAACGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUUUUCUGUAUCGUAAG---| AG C CC- A U CGUCAC CGUGUC CUUC CUCAUCACA GGA GCUG UA U GUACGG GAAG GAGUAGUGU CCU CGAC AU U GCAACCAAACAACAAGACGC^ A- U CGA - U GUUGCC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is unclear if this paralogue group represents the ancestral Mir-22-P2 gene that is seed shifted or a new paralogue derived from the ancestral P1 gene. It is also unclear if this gene is orthologous to the Mir-22-o2 gene in ambulacrarians. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bla-Mir-22-P2b_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUCAUCACACCGGAAGCUGUUA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bla-Mir-22-P2b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UCAGCUCCAGCUGUGAUGAGUG -60
Get sequence
|






