| MirGeneDB ID | Cin-Let-7-P2o1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sea Squirt (Ciona intestinalis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cin-let-7a-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cin-Let-7-P1 Cin-Let-7-P2o2 Cin-Let-7-P2o3 Cin-Let-7-P2o4 Cin-Let-7-P2o5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Aga-Let-7 Agr-Let-7 Bge-Let-7 Bko-Let-7 Bpl-Let-7 Cte-Let-7 Dan-Let-7 Dlo-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dpu-Let-7 Dsi-Let-7 Dya-Let-7 Eba-Let-7 Egr-Let-7 Esc-Let-7 Gpa-Let-7 Gsa-Let-7 Gsp-Let-7 Hme-Let-7 Hmi-Let-7 Hru-Let-7 Isc-Let-7 Lan-Let-7 Lgi-Let-7 Lhy-Let-7 Llo-Let-7 Mgi-Let-7 Mom-Let-7 Npo-Let-7 Obi-Let-7 Ofu-Let-7 Ovu-Let-7 Pau-Let-7 Pca-Let-7 Pcr-Let-7 Pdu-Let-7 Pfl-Let-7 Ple-Let-7 Pmi-Let-7 Pve-Let-7 Rph-Let-7 Sko-Let-7 Sma-Let-7 Sne-Let-7 Snu-Let-7 Spu-Let-7 Sro-Let-7 Tca-Let-7 Tur-Let-7 War-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. intestinalis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ci3) |
4: 2157422-2157502 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2o1-v1) |
Let-7-P2o1-v2
4: 2157421-2157502 [+]
UCSC
Ensembl
Let-7-P2o1-v1 4: 2157422-2157502 [+] UCSC Ensembl Let-7-P2o2 4: 2157552-2157624 [+] UCSC Ensembl Let-7-P2o3 4: 2157948-2158018 [+] UCSC Ensembl Let-7-P2o4 4: 2158141-2158206 [+] UCSC Ensembl Let-7-P2o5 4: 2158340-2158414 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Cin-Let-7-P2o1-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACCACCGAAACAACAUGGCCGUGACCACAAUGAGGUAGUAGGUUAUGCAGUUAUAGCCUCCCUUUUAUACUGAGUGGAGCACAGGAGAUACUGUGUAACCUUCUGCCUUUGUGGCUUCGUGUUUCUAUCAUCAGCUCCCACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 70 ACCACCGAAACAACAUG-- -| UGA AU U UAUAGCCUCCCUUUUAUA GC CG CCACA GAGGUAG AGGUUAUGCAGU C UG GC GGUGU UUCCGUC UCCAAUGUGUCA U CACCCUCGACUACUAUCUU U^ UUC -- U UAGAGGACACGAGGUGAG . 130 120 110 100 90 80 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This paralogue is related to the vertebrate P2s but it is not yet possible to disentangle the phylogenetic history of vertebrate Let-7 P2s and thus the ascidian genes are classified as orphans pending further data. There is also a second Dicer cut -1 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cin-Let-7-P2o1-v1_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0006086 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAGGUAGUAGGUUAUGCAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cin-Let-7-P2o1-v1_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0015247 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
60- CUGUGUAACCUUCUGCCUUUG -81
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Cin-Let-7-P2o1-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGAGGUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACCACCGAAACAACAUGGCCGUGACCACAAUGAGGUAGUAGGUUAUGCAGUUAUAGCCUCCCUUUUAUACUGAGUGGAGCACAGGAGAUACUGUGUAACCUUCUGCCUUUGUGGCUUCGUGUUUCUAUCAUCAGCUCCCACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 70 GACCACCGAAACAACAU- -| UGA AU U UAUAGCCUCCCUUUUAUA GGC CG CCACA GAGGUAG AGGUUAUGCAGU C UUG GC GGUGU UUCCGUC UCCAAUGUGUCA U CACCCUCGACUACUAUCU U^ UUC -- U UAGAGGACACGAGGUGAG 140 130 120 110 100 90 80 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This paralogue is related to the vertebrate P2s but it is not yet possible to disentangle the phylogenetic history of vertebrate Let-7 P2s and thus the ascidian genes are classified as orphans pending further data. There is also a second Dicer cut -1 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cin-Let-7-P2o1-v2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0006086 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUGAGGUAGUAGGUUAUGCAGU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cin-Let-7-P2o1-v2_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0015247 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
62- UGUGUAACCUUCUGCCUUUG -82
Get sequence
|






