| MirGeneDB ID | Cja-Mir-138-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-138 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | White-tufted-ear marmoset (Callithrix jacchus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cja-Mir-138-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-138-P2 Ami-Mir-138-P2 Bta-Mir-138-P2 Cfa-Mir-138-P2 Cli-Mir-138-P2 Cmi-Mir-138-P2 Cpi-Mir-138-P2 Cpo-Mir-138-P2 Dno-Mir-138-P2 Dre-Mir-138-P2 Eca-Mir-138-P2 Ete-Mir-138-P2 Gga-Mir-138-P2 Gja-Mir-138-P2 Gmo-Mir-138-P2 Hsa-Mir-138-P2 Laf-Mir-138-P2 Lch-Mir-138-P2 Loc-Mir-138-P2 Mal-Mir-138-P2 Mdo-Mir-138-P2 Mml-Mir-138-P2 Mmr-Mir-138-P2 Mmu-Mir-138-P2 Neu-Mir-138-P2 Oan-Mir-138-P2 Ocu-Mir-138-P2 Pab-Mir-138-P2 Pbv-Mir-138-P2 Pma-Mir-138-o2 Rno-Mir-138-P2 Sha-Mir-138-P2 Spt-Mir-138-P2 Sto-Mir-138-P2 Tgu-Mir-138-P2 Tni-Mir-138-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_011100555.2_mCalJa1.2.pat.X_genomic) |
CM021934.1: 11393927-11393997 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GCUGGUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAGCCGGCGGAGUUCUGGUAUCGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCAUACCCAUCCUCUCCAGGCGAGCCUCGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AAGCCGGCGGAGUUCUG------| CGU U AG UCA ACGAGCAGCG GUAU UGC GC CUGGUGUUGUGAA GGCCG C CAUA ACG UG GACCACAGCACUU UCGGC A GCUCCGAGCGGACCUCUCCUACC^ CU- U G- UA- CCAUUCUCCU . 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although usually templated it is assummed that Mir-138-P2 is often a Group 2 miRNA given the available 3' DcRNA reads as well as a mutation in python and some of the fish at the very 3' terminus that supports the terminal addition of the 3' uridine. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cja-Mir-138-P2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cja-Mir-138-P2_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
47- GCUAUUUCACGACACCAGGGUUGC -71
Get sequence
|






