| MirGeneDB ID | Cli-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rock pigeon (Columba livia) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cli-mir-92-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cli-Mir-92-P1a Cli-Mir-92-P2a Cli-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P1c Ami-Mir-92-P1c Asu-Mir-92 Bfl-Mir-92-o1 Bla-Mir-92-o1 Bta-Mir-92-P1c Cel-Mir-92 Cfa-Mir-92-P1c Cja-Mir-92-P1c Cmi-Mir-92-P1c Cpi-Mir-92-P1c Cpo-Mir-92-P1c Dno-Mir-92-P1c Eca-Mir-92-P1c Esc-Mir-92 Ete-Mir-92-P1c Gga-Mir-92-P1c Gja-Mir-92-P1c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P1c Isc-Mir-92 Laf-Mir-92-P1c Mdo-Mir-92-P1c Mml-Mir-92-P1c Mmr-Mir-92-P1c Mmu-Mir-92-P1c Mun-Mir-92-P1c Neu-Mir-92-P1c Oan-Mir-92-P1c Obi-Mir-92 Ocu-Mir-92-P1c Pab-Mir-92-P1c Pbv-Mir-92-P1c Rno-Mir-92-P1c Sha-Mir-92-P1c Sme-Mir-92 Spt-Mir-92-P1c Sto-Mir-92-P1c Tgu-Mir-92-P1c Xla-Mir-92-P1c3 Xla-Mir-92-P1c4 Xtr-Mir-92-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (colLiv2) |
scaffold72: 3451822-3451883 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P1c) |
Mir-92-P2c
scaffold72: 3451682-3451746 [-]
Mir-92-P1c scaffold72: 3451822-3451883 [-] Mir-19-P2c scaffold72: 3451991-3452050 [-] Mir-17-P4c scaffold72: 3452115-3452175 [-] Mir-17-P2c scaffold72: 3452309-3452373 [-] Mir-17-P1c scaffold72: 3452469-3452526 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCUCAAGAUGCCUUGCGCUGGUUUCUCCAUGGGUGGGGAUUUGUUGCAUUACUUGUAGCUGUAUGUAGAGUAUUGCACUUGUCCCGGCCUGUGGAGGAAAUGAGGACUUGUCUUCAGGCUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UCUCAAGAUGCCUUGCG- G -| G UU U U UGUAGCU CU GUUU CUCCAUGGGU GGGAU GU GCA UACU \ GA UAAA GAGGUGUCCG CCCUG CA CGU AUGA G CGUCGGACUUCUGUUCAG G G^ G UU - U GAUGUAU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut on the 5p arm +2 relative as well as a second Dicer cut +1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cli-Mir-92-P1c_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038475 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGUGGGGAUUUGUUGCAUUACU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cli-Mir-92-P1c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038474 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- UAUUGCACUUGUCCCGGCCUGU -62
Get sequence
|






