| MirGeneDB ID | Dan-Mir-10-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-10 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila ananassae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dan-Mir-10-P1 Dan-Mir-10-P2 Dan-Mir-10-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-10-P4 Adi-Mir-10 Aga-Mir-10-P4 Asp-Mir-10 Asu-Mir-10-P4 Ava-Mir-10-P4 Bge-Mir-10-P4 Bko-Mir-10-P4o1 Bko-Mir-10-P4o2 Bpl-Mir-10-P4 Csc-Mir-10-P4q Csc-Mir-10-P4r Cte-Mir-10-P4 Dgr-Mir-10-P4 Dlo-Mir-10-P4-v1 Dma-Mir-10-P4 Dme-Mir-10-P4 Dmo-Mir-10-P4 Dpu-Mir-10-P4 Dsi-Mir-10-P4 Dya-Mir-10-P4 Efe-Mir-10-P4a Efe-Mir-10-P4b Efe-Mir-10-P4c Gpa-Mir-10-P4 Gsa-Mir-10-P4 Hme-Mir-10-P4 Isc-Mir-10-P4 Lan-Mir-10-P4d Lan-Mir-10-P4e Llo-Mir-10-P4-v1 Lpo-Mir-10-P4j Lpo-Mir-10-P4k Lpo-Mir-10-P4l Lpo-Mir-10-P4m Lpo-Mir-10-P4n Nve-Mir-10 Ofu-Mir-10-P4 Pca-Mir-10-P4 Pcr-Mir-10-P4s1 Pcr-Mir-10-P4s2 Pcr-Mir-10-P4t Pdu-Mir-10-P4 Pdu-Mir-10-P4-as Snu-Mir-10-P4 Tca-Mir-10-P4 Tur-Mir-10-P4u Tur-Mir-10-P4v Tur-Mir-10-P4w | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eumetazoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Dana_caf1) |
scaffold_13340: 5446749-5446840 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-10-P4) |
Mir-10-P1
scaffold_13340: 5417376-5417438 [+]
Ensembl
Mir-10-P4 scaffold_13340: 5446749-5446840 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAGCUCG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACGAUCUUCAAUUGAAACGCUCCCGUGACCUACCCUGUAGUUCCGGGCUUUUGUUUAUAUUGCGUUCGAUGCAUUGUCGGACUGCUGGCUCGAUUAUCAGAAGCUCGUCUCUACAGGUAUCUCACAGGGUAGAAAGAAACAACAUUUCGAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 70 ACGAUCUUCAAUUGAAACG- - -| CC C UUC UUUAUAUUGCGUUCGAUGCAU CU CCC GUGA UACC UGUAG CGGGCUUUUG U GA GGG CACU AUGG ACAUC GCUCGAAGAC G GAAGCUUUACAACAAAGAAA U A^ CU - UCU UAUUAGCUCGGUCGUCAGGCU 150 140 130 120 110 100 90 80 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut -1 on the 5p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dan-Mir-10-P4_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UACCCUGUAGUUCCGGGCUUUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dan-Mir-10-P4_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
69- GAAGCUCGUCUCUACAGGUAUCU -92
Get sequence
|






