| MirGeneDB ID | Dme-Mir-929 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-929 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila melanogaster) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dme-mir-929 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-929-P1 Aae-Mir-929-P2 Aga-Mir-929 Bge-Mir-929-v1 Dan-Mir-929 Dlo-Mir-929-v1 Dmo-Mir-929 Dsi-Mir-929 Dya-Mir-929 Gpa-Mir-929 Hme-Mir-929 Tca-Mir-929 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Neoptera | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Neoptera | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_melanogaster_BDGP6) |
3R: 4295385-4295441 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUUGAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GACAUGGCGGAACCAGUCCUGGUGGAGCUCAAAUUGACUCUAGUAGGGAGUCCUUUAAUGAGCGACUCCCUAACGGAGUCAGAUUGAGCUGCAAAGGAGCGACACAACAGAGGAGCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GACAUGGCGGAACCAGU---| GG G A AG CUUUA CCU UG AGCUCAA UUGACUCU UAGGGAGUC \ GGA AC UCGAGUU GACUGAGG AUCCCUCAG A ACGAGGAGACAACACAGCGA^ A- G A CA CGAGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms. This might be a result of a second Drosha cut shifted again -1. In which case the 3p arm is the mature form of this minor set of reads. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dme-Mir-929_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0020892 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAAUUGACUCUAGUAGGGAGUC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dme-Mir-929_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0005511 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- CUCCCUAACGGAGUCAGAUUGA -57
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0005511 TargetScanFly: dme-miR-929 |






