| MirGeneDB ID | Ete-Mir-128-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-128 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-128-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-128-P1 Ami-Mir-128-P1 Bta-Mir-128-P1 Cfa-Mir-128-P1 Cja-Mir-128-P1 Cli-Mir-128-P1 Cmi-Mir-128-P1 Cpi-Mir-128-P1 Cpo-Mir-128-P1 Dno-Mir-128-P1 Dre-Mir-128-P1 Ebu-Mir-128 Eca-Mir-128-P1 Gga-Mir-128-P1 Gja-Mir-128-P1 Gmo-Mir-128-P1 Hsa-Mir-128-P1 Laf-Mir-128-P1 Lch-Mir-128-P1 Loc-Mir-128-P1 Mal-Mir-128-P1 Mdo-Mir-128-P1 Mml-Mir-128-P1 Mmr-Mir-128-P1 Mmu-Mir-128-P1 Mun-Mir-128-P1 Neu-Mir-128-P1 Oan-Mir-128-P1 Ocu-Mir-128-P1 Pab-Mir-128-P1 Pbv-Mir-128-P1 Pma-Mir-128-o1 Rno-Mir-128-P1 Sha-Mir-128-P1 Spt-Mir-128-P1 Sto-Mir-128-P1 Tgu-Mir-128-P1 Tni-Mir-128-P1 Xla-Mir-128-P1a Xla-Mir-128-P1b Xtr-Mir-128-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980310: 28263938-28263995 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGAGCCUGGCAUCCUCUGUGCAGUGGGAAGGGGGGCCGAUACACUGUCCGAGAGUGAGUAGCAGGUCUCACAGUGAACCGGUCUCUUUCCCUACUGUGUCACCCUCCUAGUGGAAUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGAGCCUGGCAUCCUCU--|UG A AUA CC GUGAG G CAGUGGG AGGGGGGCCG CACUGU GAGA U U GUCAUCC UUUCUCUGGC GUGACA CUCU A CGUAAGGUGAUCCUCCCAC^GU C CAA -- GGACG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-128-P1_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGGGCCGAUACACUGUCCGAGA -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-128-P1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UCACAGUGAACCGGUCUCUUU -58
Get sequence
|






