| MirGeneDB ID | Ete-Mir-320 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-320 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-320-P1c Bta-Mir-320-P1d Cfa-Mir-320 Cja-Mir-320-P1 Cpo-Mir-320 Dno-Mir-320 Eca-Mir-320 Hsa-Mir-320-P1 Hsa-Mir-320-P2a Hsa-Mir-320-P2b Hsa-Mir-320-P3 Hsa-Mir-320-P4 Laf-Mir-320 Mml-Mir-320-P1 Mml-Mir-320-P2a Mml-Mir-320-P2b Mml-Mir-320-P3 Mml-Mir-320-P4 Mmr-Mir-320-P1a Mmr-Mir-320-P1b Mmr-Mir-320-P1c Mmr-Mir-320-P1d Mmr-Mir-320-P5 Mmr-Mir-320-P6 Mmr-Mir-320-P7 Mmr-Mir-320-P8 Mmu-Mir-320 Ocu-Mir-320 Pab-Mir-320-P1 Pab-Mir-320-P2a Pab-Mir-320-P2b Pab-Mir-320-P3 Pab-Mir-320-P4 Rno-Mir-320 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980320: 9882431-9882484 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAAGCUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAUUUAUGCAGCGGCGCCGCGCCUCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGGCGAAAAAAGAUGAGGGUCUACGUGACGAUUUGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UAUUUAUGCAGCGGCGCCGCGCCUC ---------| UU C CGG CCUC CGCCUUCUC CCCGGUU UUCC A GGAG GCGGGAGAG GGGUCGA AAGG G GGUUUAGCAGUGCAUCUG------- UAGAAAAAA^ UU A GCU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 3, Kim et al. 2016) Drosha-independent 5' capped miRNA few star reads are cloned and sequenced. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-320_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCCUUCUCUUCCCGGUUCUUCC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-320_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
32- AAAAGCUGGGUUGAGAGGGCGA -54
Get sequence
|






