| MirGeneDB ID | Ete-Mir-338-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-338 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-338-P2-as | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-338-P2 Ami-Mir-338-P2 Bta-Mir-338-P2 Bta-Mir-338-P2-as Cfa-Mir-338-P2 Cfa-Mir-338-P2-as Cja-Mir-338-P2 Cli-Mir-338-P2 Cmi-Mir-338-P2 Cpi-Mir-338-P2 Cpi-Mir-338-P2-as Cpo-Mir-338-P2 Dno-Mir-338-P2 Dre-Mir-338-P2a Dre-Mir-338-P2b Ebu-Mir-338-o2 Eca-Mir-338-P2 Eca-Mir-338-P2-as Gga-Mir-338-P2 Gja-Mir-338-P2 Gmo-Mir-338-P2a Gmo-Mir-338-P2b Hsa-Mir-338-P2 Hsa-Mir-338-P2-as Laf-Mir-338-P2 Lch-Mir-338-P2 Loc-Mir-338-P2 Mal-Mir-338-P2a Mal-Mir-338-P2b Mdo-Mir-338-P2 Mml-Mir-338-P2 Mml-Mir-338-P2-as Mmr-Mir-338-P2 Mmu-Mir-338-P2 Mmu-Mir-338-P2-as Mun-Mir-338-P2e Mun-Mir-338-P2f Neu-Mir-338-P2 Oan-Mir-338-P2 Ocu-Mir-338-P2 Pab-Mir-338-P2 Pab-Mir-338-P2-as Pbv-Mir-338-P2 Rno-Mir-338-P2 Rno-Mir-338-P2-as Sha-Mir-338-P2 Spt-Mir-338-P2 Sto-Mir-338-P2 Tgu-Mir-338-P2 Tgu-Mir-338-P2-as Tni-Mir-338-P2a Tni-Mir-338-P2b Xla-Mir-338-P2c Xla-Mir-338-P2d Xtr-Mir-338-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
manual_Ete-Mir-338-P1: 34-91 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-338-P2) |
Mir-338-P2-as
manual_Ete-Mir-338-P1: 31-91 [-]
UCSC
Mir-338-P2 manual_Ete-Mir-338-P1: 34-91 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CCAGCAU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGCCCGGACGCCGCACGGGCCGUCCUCCCCAACAAUAUCCUGGUGCUGAGUGGUGACAAGGCGACUCCAGCAUCAGUGAUUUUGUUGAAGAGGGCAGCUGCCAGCCUCCGCCGCCGCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGCCCGGACGCCGCACG-- C CC U - -| GGUGA GGC GUCCUC CAACAA AUC CUGGUGCU GAGU C UCG CGGGAG GUUGUU UAG GACUACGA CUCA A CCGCCGCCGCCUCCGACCG A AA U U C^ GCGGA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Not in assembly but in trace archive. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-338-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AACAAUAUCCUGGUGCUGAGU -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-338-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UCCAGCAUCAGUGAUUUUGUUGA -58
Get sequence
|






