| MirGeneDB ID | Gja-Mir-192-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-192 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-192-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-192-P4 Bta-Mir-192-P4 Cfa-Mir-192-P4 Cja-Mir-192-P4 Cpi-Mir-192-P4 Cpo-Mir-192-P4 Dno-Mir-192-P4 Dre-Mir-192-P4b Eca-Mir-192-P4 Ete-Mir-192-P4 Gmo-Mir-192-P4b Hsa-Mir-192-P4 Loc-Mir-192-P4 Mal-Mir-192-P4b Mml-Mir-192-P4 Mmr-Mir-192-P4 Mmu-Mir-192-P4 Mun-Mir-192-P4 Neu-Mir-192-P4 Oan-Mir-192-P4 Ocu-Mir-192-P4 Pab-Mir-192-P4 Rno-Mir-192-P4 Sha-Mir-192-P4 Spt-Mir-192-P4 Tni-Mir-192-P4b-v1 Xla-Mir-192-P4c Xla-Mir-192-P4d Xtr-Mir-192-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015165831.1: 1121834-1121897 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-192-P4) |
Mir-192-P4
NW_015165831.1: 1121834-1121897 [-]
Mir-194-P4 NW_015165831.1: 1123408-1123465 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGACCUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCUUCGGCUUCGGAUCGAGGGCACACAGCUAUGACCUAUGAAUUGACAGCCAGUCCUCCUACUCCUUCCUGGCUGUCAGUUCUGUAGGGCACAAGUUUGUCCCCCUCCAUGGCCACCACCCACGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCUUCGGCUUCGGAUCGA-- C C A- A -| AGUCCUCCU GGG ACA AGCU UG CCUAU GAAUUGACAGCC \ CCC UGU UUGA AC GGAUG CUUGACUGUCGG A GCACCCACCACCGGUACCUC C - AC G U^ UCCUUCCUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There are Dicer cuts +1 and +2 on both arms, and a Dicer cut +3 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-192-P4_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUGACCUAUGAAUUGACAGCC -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-192-P4_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- CUGUCAGUUCUGUAGGGCACAA -64
Get sequence
|






