| MirGeneDB ID | Lan-Mir-92-o85 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lingula (Lingula anatina) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lan-Mir-92-o79a Lan-Mir-92-o79b Lan-Mir-92-o80a Lan-Mir-92-o80b Lan-Mir-92-o81 Lan-Mir-92-o82 Lan-Mir-92-o83 Lan-Mir-92-o84 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | L. anatina | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (LinAna_1.0) |
LFEI01000686: 142810-142869 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o85) |
Mir-92-o84
LFEI01000686: 142666-142724 [+]
Ensembl
Mir-92-o85 LFEI01000686: 142810-142869 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAUUUGCCACACUGUCCUGUAUACUUGAGCAGGUCUUGAUGCGUGCAAUUUUGUUUUUUUUUAAAGCAAAUUGCACGCGUCCCGGCCUACUUGAAUAACCAUUAACAGCAGAGCUUUGACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAUUUGCCACACUGUCC--| UA C UG C UU U UUUUU UG UA U AG AGGUC GAUGCGUGCAAUUU GU \ AC AU A UC UCCGG CUGCGCACGUUAAA CG U CAGUUUCGAGACGACAAUU^ CA A GU A CC - AAAUU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lan-Mir-92-o85_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCUUGAUGCGUGCAAUUUUGU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lan-Mir-92-o85_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- AAUUGCACGCGUCCCGGCCUAC -60
Get sequence
|






