| MirGeneDB ID | Llo-Mir-2-o120 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Bootlace worm (Lineus longissimus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Llo-Mir-2-o114-v1 Llo-Mir-2-o115 Llo-Mir-2-o116 Llo-Mir-2-o117 Llo-Mir-2-o118 Llo-Mir-2-o119 Llo-Mir-2-o121 Llo-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Lineidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_910592395.2_tnLinLong1) |
OU343000.1: 4140870-4140930 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o120) |
Mir-2-o121
OU343000.1: 4140571-4140629 [+]
Ensembl
Mir-2-o120 OU343000.1: 4140870-4140930 [+] Ensembl Mir-2-o119 OU343000.1: 4142150-4142210 [+] Ensembl Mir-2-o118 OU343000.1: 4142445-4142502 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCGAUCUCGGUGUUCUUGCCAAUUUUACGCUCCACAAAGUGGCUUUGAAAUGCUGACAUCAAUGGUUUAUCACAGCCUGCUUUGAUGGGCUGCAAAAUUGGCCGGUCGAUUAACCCCUUCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GCGAUCUCGGUGUUCUU-- A - U - -| U AAUGCUGACA GCCAAUUUU C GC CCA CAAAGU GGCU UGA \ CGGUUAAAA G CG GGU GUUUCG CCGA ACU U CCUUCCCCAAUUAGCUGGC C U - A U^ C AUUUGGUAAC . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Llo-Mir-2-o120_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCCACAAAGUGGCUUUGAAAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Llo-Mir-2-o120_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUCACAGCCUGCUUUGAUGGGCU -61
Get sequence
|






