| MirGeneDB ID | Mal-Let-7-P2b4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | LET-7 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Asian swamp eel (Monopterus albus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Mal-Let-7-P1b1 Mal-Let-7-P1b2 Mal-Let-7-P1c2 Mal-Let-7-P1d1 Mal-Let-7-P1d2 Mal-Let-7-P2a1a Mal-Let-7-P2a2a Mal-Let-7-P2a2b Mal-Let-7-P2a3a Mal-Let-7-P2a3b Mal-Let-7-P2a4a Mal-Let-7-P2a4b Mal-Let-7-P2b1a Mal-Let-7-P2b2a Mal-Let-7-P2b2b Mal-Let-7-P2b3a Mal-Let-7-P2b4b Mal-Let-7-P2c2b Mal-Let-7-P2c3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Let-7 Aca-Let-7-P2b4 Aga-Let-7 Agr-Let-7 Ami-Let-7-P2b4 Bge-Let-7 Bko-Let-7 Bpl-Let-7 Cli-Let-7-P2b4 Cmi-Let-7-P2b4 Cpi-Let-7-P2b4 Cte-Let-7 Dan-Let-7 Dlo-Let-7 Dma-Let-7 Dme-Let-7 Dmo-Let-7 Dpu-Let-7 Dre-Let-7-P2b4a Dre-Let-7-P2b4b Dsi-Let-7 Dya-Let-7 Eba-Let-7 Egr-Let-7 Esc-Let-7 Gga-Let-7-P2b4 Gja-Let-7-P2b4 Gmo-Let-7-P2b4a Gmo-Let-7-P2b4b Gpa-Let-7 Gsa-Let-7 Gsp-Let-7 Hme-Let-7 Hmi-Let-7 Hru-Let-7 Isc-Let-7 Lan-Let-7 Lch-Let-7-P2b4 Lgi-Let-7 Lhy-Let-7 Llo-Let-7 Loc-Let-7-P2b4 Mgi-Let-7 Mom-Let-7 Mun-Let-7-P2b4 Npo-Let-7 Oan-Let-7-P2b4 Obi-Let-7 Ofu-Let-7 Ovu-Let-7 Pau-Let-7 Pbv-Let-7-P2b4 Pca-Let-7 Pcr-Let-7 Pdu-Let-7 Pfl-Let-7 Ple-Let-7 Pmi-Let-7 Pve-Let-7 Rph-Let-7 Sko-Let-7 Sma-Let-7 Sne-Let-7 Snu-Let-7 Spt-Let-7-P2b4 Spu-Let-7 Sro-Let-7 Tca-Let-7 Tgu-Let-7-P2b4 Tni-Let-7-P2b4a Tni-Let-7-P2b4b Tur-Let-7 War-Let-7 Xbo-Let-7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Clupeocephala | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_001952655.1_M_albus_1.0_genomic) |
KV884694.1: 1086043-1086119 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Let-7-P2b4a) |
Let-7-P2b4a
KV884694.1: 1086043-1086119 [-]
UCSC
Ensembl
Let-7-P2a4a KV884694.1: 1086324-1086396 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGGUAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUGGUGUGUUUGAUUUGGGCUCUGUCAGGGUGAGGUAGUAGGUUGUAUAGUUUGGUGGGUGGGAUUGCACCCUGCUCAGGUGAUAACUAUACAGUCUAUUGCCUUCCUUGAGGAGCUCACUGAACAUUCAGUGAUAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUGGUGUGUUUGAUUUG---| G U GU UGGUGGGUGGGAUUG GGCUCU UCAGGG GAGGUAGUAG UGUAUAGUU C UCGAGG AGUUCC UUCCGUUAUC ACAUAUCAA A UAUAGUGACUUACAAGUCAC^ - - UG UAGUGGACUCGUCCC 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the conservation of Let7-P2 processing. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mal-Let-7-P2b4a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mal-Let-7-P2b4a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
56- CUAUACAGUCUAUUGCCUUCC -77
Get sequence
|






