| MirGeneDB ID | Oan-Mir-34-P3b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-34 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Platypus (Ornithorhynchus anatinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | oan-mir-449b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Oan-Mir-34-P1 Oan-Mir-34-P2a Oan-Mir-34-P2b Oan-Mir-34-P3a Oan-Mir-34-P3c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-34 Aga-Mir-34 Agr-Mir-34 Ami-Mir-34-P3b Asu-Mir-34 Bge-Mir-34 Bta-Mir-34-P3b Cbr-Mir-34 Cel-Mir-34 Cfa-Mir-34-P3b Cin-Mir-34 Cja-Mir-34-P3b Cli-Mir-34-P3b Cmi-Mir-34-P3b Cpi-Mir-34-P3b Cte-Mir-34 Dan-Mir-34 Dlo-Mir-34 Dma-Mir-34 Dme-Mir-34 Dmo-Mir-34 Dno-Mir-34-P3b Dpu-Mir-34 Dsi-Mir-34 Dya-Mir-34 Eca-Mir-34-P3b Efe-Mir-34 Esc-Mir-34 Ete-Mir-34-P3b Gga-Mir-34-P3b Gja-Mir-34-P3b Gpa-Mir-34 Gsp-Mir-34 Hmi-Mir-34 Hru-Mir-34 Hsa-Mir-34-P3b Isc-Mir-34 Laf-Mir-34-P3b Lch-Mir-34-P3b Lgi-Mir-34 Lhy-Mir-34 Llo-Mir-34 Loc-Mir-34-P3b Mdo-Mir-34-P3b Mgi-Mir-34 Mml-Mir-34-P3b Mmr-Mir-34-P3b Mmu-Mir-34-P3b Mom-Mir-34 Neu-Mir-34-P3b Npo-Mir-34 Obi-Mir-34 Ocu-Mir-34-P3b Ofu-Mir-34 Ovu-Mir-34 Pab-Mir-34-P3b Pau-Mir-34 Pbv-Mir-34-P3b Pca-Mir-34 Pdu-Mir-34 Pfl-Mir-34 Pma-Mir-34-P3 Pmi-Mir-34 Pve-Mir-34 Rno-Mir-34-P3b Rph-Mir-34 Sha-Mir-34-P3b Sko-Mir-34 Snu-Mir-34 Spt-Mir-34-P3b Spu-Mir-34 Sto-Mir-34-P3b Tca-Mir-34 Tur-Mir-34 War-Mir-34 Xla-Mir-34-P3b1 Xla-Mir-34-P3b2 Xtr-Mir-34-P3b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (mOrnAna1.p.v1_plustraces) |
NC_041728.1: 7246184-7246244 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-34-P3b) |
Mir-34-P3c
NC_041728.1: 7246045-7246105 [-]
Mir-34-P3b NC_041728.1: 7246184-7246244 [-] Mir-34-P3a NC_041728.1: 7247559-7247619 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GGCAGUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGAGCAUCAGUGACAUUACCUGGGUCAAGUAGGCAGUGUGAUGUUUGCUGGCUGCUUUGAAUCGAUUCAGCAGCCACCGUUACUCUGCCACUUGCUACUAGGCGGACUCAUCCUUUCGAGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGAGCAUCAGUGACAUUA- GU- A U U---| GCUGCUUU CCUGG CAAGU GGCAG GUGAUG UUGCUG \ GGAUC GUUCA CCGUC CAUUGC GACGAC G CGAGCUUUCCUACUCAGGC AUC - U CACC^ UUAGCUAA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This is a Group 2 in human according to Kim et al but because there is a templated 3' U it is not possible according to read data to classify it as such in other taxa although the secondary structure is consistent with this categorization. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Oan-Mir-34-P3b_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0007013 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGCAGUGUGAUGUUUGCUGG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Co-mature sequence | Oan-Mir-34-P3b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0007014 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CAGCCACCGUUACUCUGCCAC -61
Get sequence
|






