| MirGeneDB ID | Snu-Mir-216-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-216 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Snu-Mir-216-P1 Snu-Mir-216-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-216-P2 Aga-Mir-216-P2 Agr-Mir-216-P2c Asu-Mir-216-P2 Ava-Mir-216-P2 Bfl-Mir-216-P2 Bge-Mir-216-P2 Bko-Mir-216-P2 Bla-Mir-216-P2 Bpl-Mir-216-P2 Cbr-Mir-216-P2 Cel-Mir-216-P2 Csc-Mir-216-P2 Cte-Mir-216-P2c Dan-Mir-216-P2 Dgr-Mir-216-P2c Dlo-Mir-216-P2 Dma-Mir-216-P2 Dme-Mir-216-P2 Dmo-Mir-216-P2 Dpu-Mir-216-P2 Dsi-Mir-216-P2 Dya-Mir-216-P2 Eba-Mir-216-P2c Efe-Mir-216-P2c Hme-Mir-216-P2 Isc-Mir-216-P2 Lhy-Mir-216-P2c Llo-Mir-216-P2c Mom-Mir-216-P2c Npo-Mir-216-P2c Obi-Mir-216-P2c Ofu-Mir-216-P2c Ovu-Mir-216-P2c Pau-Mir-216-P2c Pca-Mir-216-P2 Tca-Mir-216-P2 Tur-Mir-216-P2 War-Mir-216-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Lophotrochozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Nephrozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049308.1: 11133197-11133256 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-216-P2c) |
Mir-12
CM049308.1: 11128211-11128272 [-]
Mir-216-P2d CM049308.1: 11130439-11130498 [-] Mir-216-P1 CM049308.1: 11132643-11132702 [-] Mir-216-P2c CM049308.1: 11133197-11133256 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AAUCUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CACUCACUGUAUUAACAAUGAGCUGUUGCAUAAUCUCAGCUGGUAAGUUCAGAGAGAUGACGUGACUCGAAUCUACUCGCUGAGAUUCUGCAAAAGCUUAAUACUAACAACAAUUGUGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CACUCACUGUAUUAACAA-- G U U AG -| AGAGAU UGAGCU UUGCA AAUCUCAGC GGUA UUC AG \ AUUCGA AACGU UUAGAGUCG UCAU AAG UC G GUGUGUUAACAACAAUCAUA A C C CU C^ AGUGCA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Snu-Mir-216-P2c_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAAUCUCAGCUGGUAAGUUCAG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Snu-Mir-216-P2c_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GAAUCUACUCGCUGAGAUUCUG -60
Get sequence
|






