| MirGeneDB ID | Snu-Mir-29-P2r | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-29 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Snu-Mir-29-P1 Snu-Mir-29-P2q | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-29-P2 Asu-Mir-29-P2 Bfl-Mir-29-P2 Bla-Mir-29-P2 Cbr-Mir-29-P2 Cel-Mir-29-P2 Cte-Mir-29-P2 Dgr-Mir-29-P2 Dma-Mir-29-P2 Dpu-Mir-29-P2 Eba-Mir-29-P2 Esc-Mir-29-P2 Gsp-Mir-29 Hru-Mir-29-P2 Lgi-Mir-29-P2 Lhy-Mir-29-P2 Llo-Mir-29-P2 Mgi-Mir-29-P2 Mom-Mir-29-P2 Npo-Mir-29-P2 Obi-Mir-29-P2 Ofu-Mir-29-P2 Ovu-Mir-29-P2 Pau-Mir-29-P2 Pcr-Mir-29-P2 Pdu-Mir-29-P2 Pfl-Mir-29-P2 Pmi-Mir-29-P2 Pve-Mir-29-P2 Rph-Mir-29-P2 Sko-Mir-29-P2 Sme-Mir-29-o2 Spu-Mir-29-P2 War-Mir-29-P2 Xbo-Mir-29-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | S. nudus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049312.1: 13486724-13486781 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCACCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAGAAAGCGAUAAAAUUGUUGCAAGGAGCCCCUGGCAUCUUCCGGUGAAUUGUGGCCACAUACAACAAGCACCAGUAGAUAUCAGGGAUGACUUGCAACUCUGCAUCUUACUGUAGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AAGAAAGCGAUAAAAUU--| GAGC GC UCC AA GGCCA GUUGCAAG CCCUG AUCU GGUG UUGU \ CAACGUUC GGGAC UAGA CCAC AACA C GUGAUGUCAUUCUACGUCU^ AGUA UA UGA G- ACAUA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Snu-Mir-29-P2r_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CCUGGCAUCUUCCGGUGAAUUGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Snu-Mir-29-P2r_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- AAGCACCAGUAGAUAUCAGGGA -58
Get sequence
|






