| MirGeneDB ID | Spu-Mir-92-o15 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Purple sea urchin (Strongylocentrotus purpuratus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | spu-mir-92c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Spu-Mir-92-o13 Spu-Mir-92-o14 Spu-Mir-92-o16 Spu-Mir-92-o17 Spu-Mir-92-o18 Spu-Mir-92-o19 Spu-Mir-92-o20 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Bge-Mir-92-P15 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | S. purpuratus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Spur_5.0) |
AAGJ06000006.1: 26944977-26945042 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o15) |
Mir-92-o17
AAGJ06000006.1: 26943673-26943760 [-]
Ensembl
Mir-92-o16 AAGJ06000006.1: 26944529-26944593 [-] Ensembl Mir-92-o15 AAGJ06000006.1: 26944977-26945042 [-] Ensembl Mir-92-o14 AAGJ06000006.1: 26946651-26946718 [-] Ensembl Mir-92-o13 AAGJ06000006.1: 26954701-26954769 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCUCUCCAUCAUCAGUAGAGGGCAGCAAGCUGGUCGUGAGGAGUUGCAAUUUGUCCACAUGAUAAUAAUCAUCAUAUUGCACUCGUCCCGGCCUGCCUGCUUGCCCUCAAUCUCAGGACCAACGAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UCUCUCCAUCAUCAGUA- -| A U U G U U UCCACAUGA GAGGGC AGCA GC GGUCG GA GAGU GCAAU UG \ CUCCCG UCGU CG CCGGC CU CUCA CGUUA AC U AAGCAACCAGGACUCUAA U^ C U C G - U UACUAAUAA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Spu-Mir-92-o15_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGUCGUGAGGAGUUGCAAUUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Spu-Mir-92-o15_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009664 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
44- UAUUGCACUCGUCCCGGCCUGC -66
Get sequence
|
