| MirGeneDB ID | Bfl-Mir-92-o3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | bfl-mir-92c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o4 Bfl-Mir-92-o5 Bfl-Mir-92-o6 Bfl-Mir-92-o7 Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-92-P3 Aga-Mir-92-P3 Asu-Mir-92 Bge-Mir-92-P3 Bla-Mir-92-o3 Cel-Mir-92 Dan-Mir-92-P3 Dlo-Mir-92-P3 Dma-Mir-92-P3 Dme-Mir-92-P3 Dmo-Mir-92-P3 Dpu-Mir-92-P3 Dsi-Mir-92-P3 Dya-Mir-92-P3 Esc-Mir-92 Gpa-Mir-92-P3 Gsp-Mir-92 Hme-Mir-92-P3 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Tca-Mir-92-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049981.1: 13639020-13639073 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o3) |
Mir-92-o3
NC_049981.1: 13639020-13639073 [+]
UCSC
Mir-92-o4 NC_049981.1: 13639441-13639502 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UAAAAUUUAGCGGUUUUGUUUUUGGCGGGAAGGUCGGGAGAAGAAACAAUGUUUCCAACCGAUAUUGCACUUGUCCCGGCUUGCCUGCUGCCGCCAUCUUGCUCCAGACAUGACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UAAAAUUUAGCGGUUUUGUUUUU--| A G AAA UCC GGCGGG AGGUCGGGA AAG CAAUGUU \ UCGUCC UUCGGCCCU UUC GUUAUAG A CAGUACAGACCUCGUUCUACCGCCG^ G G AC- CCA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bfl-Mir-92-o3_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCGGGAGAAGAAACAAUGUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bfl-Mir-92-o3_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0010010 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
32- UAUUGCACUUGUCCCGGCUUGC -54
Get sequence
|






