| MirGeneDB ID | Cel-Bantam-P5b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | BANTAM (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Roundworm (Caenorhabditis elegans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cel-mir-2209b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cel-Bantam-P1 Cel-Bantam-P2 Cel-Bantam-P3 Cel-Bantam-P4 Cel-Bantam-P5a Cel-Bantam-P5c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Bantam Aga-Bantam Agr-Bantam Bge-Bantam Bko-Bantam Bpl-Bantam Cte-Bantam Dan-Bantam Dgr-Bantam Dlo-Bantam Dma-Bantam Dme-Bantam Dmo-Bantam Dpu-Bantam Dsi-Bantam Dya-Bantam Eba-Bantam Esc-Bantam Gpa-Bantam Gsa-Bantam Gsp-Bantam Hme-Bantam Hru-Bantam Lan-Bantam Lgi-Bantam Lhy-Bantam Llo-Bantam Mgi-Bantam Mom-Bantam Nag-Bantam Npo-Bantam Ofu-Bantam Ovu-Bantam Pau-Bantam Pcr-Bantam Ple-Bantam Pve-Bantam Sma-Bantam Sne-Bantam Snu-Bantam Tca-Bantam Tur-Bantam War-Bantam | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. elegans | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (ce11) |
chrIV: 1021303-1021365 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Bantam-P5b) |
Bantam-P5b
chrIV: 1021303-1021365 [-]
UCSC
Ensembl
Mir-2208-P1 chrIV: 1021772-1021832 [+] UCSC Ensembl Mir-2208-P2 chrIV: 1026580-1026640 [+] UCSC Ensembl Bantam-P5a chrIV: 1027102-1027164 [+] UCSC Ensembl Bantam-P5c chrIV: 1027219-1027281 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAGAUGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCUGAACAGCCCUGGCUCCCGGGAAUGGUGAGUGUAACAACUCUUCUCCUUCCGAAAACCAAUAAUCGAGAAGAGAUGAGCGGUUGUGCUUCACCAUUGGUAGGGAGUCUCCACCAGGGGUGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCUGAACAGCCCUGGCU- GGG- -| UG AA U C CGAAAACC CCC AAUGGUG AG UAAC CUC UCUC UUC \ GGG UUACCAC UC GUUG GAG AGAG AAG A UGUGGGGACCACCUCUGA AUGG U^ GU GC U - AGCUAAUA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cel-Bantam-P5b_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0011453 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGUGUAACAACUCUUCUCCUUC -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0011453 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cel-Bantam-P5b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0011454 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
41- AGAGAUGAGCGGUUGUGCUUCA -63
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0011454 TargetScanWorm: cel-miR-2209b |






