| MirGeneDB ID | Cpo-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-145 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Guinea pig (Cavia porcellus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cpo-mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-145 Ami-Mir-145 Bta-Mir-145 Cfa-Mir-145 Cja-Mir-145 Cli-Mir-145 Cmi-Mir-145 Cpi-Mir-145 Dno-Mir-145 Dre-Mir-145 Ebu-Mir-145 Eca-Mir-145 Ete-Mir-145 Gga-Mir-145 Gja-Mir-145 Gmo-Mir-145 Hsa-Mir-145 Laf-Mir-145 Lch-Mir-145 Loc-Mir-145 Mal-Mir-145 Mdo-Mir-145 Mml-Mir-145 Mmr-Mir-145 Mmu-Mir-145 Mun-Mir-145 Neu-Mir-145 Oan-Mir-145 Ocu-Mir-145 Pab-Mir-145 Pbv-Mir-145 Pma-Mir-145 Rno-Mir-145 Sha-Mir-145 Spt-Mir-145 Sto-Mir-145 Tgu-Mir-145 Xla-Mir-145-P1 Xla-Mir-145-P2 Xtr-Mir-145 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (cavPor3) |
scaffold_6: 11377829-11377888 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-145) |
Mir-143
scaffold_6: 11376289-11376343 [+]
UCSC
Mir-145 scaffold_6: 11377829-11377888 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCCAGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGACGGCCGCUCUCACACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUGGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCACGGUUUAGCAGCUGGACUCACCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGACGGCCGCUCUCACA--| U U C UC U C UGGAUG CC UG CCUCA GG CAGU UU CCAGGAAUCCCU \ GG AC GGAGU UC GUCA AA GGUCCUUAGGGG C CCACUCAGGUCGACGAUUU^ C U - UU U A UAGAAU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -2 on both arms. Although there is a templated T at the 3' end of the 3p arm, this transcript is annotated as a Group 2 miRNA given the CAGE data in human and the 5' starting cut of 3' offset reads in various vertebrate taxa. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cpo-Mir-145_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047014 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GUCCAGUUUUCCCAGGAAUCCCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cpo-Mir-145_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0047015 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- GGAUUCCUGGAAAUACUGUUCU -60
Get sequence
|






