| MirGeneDB ID | Dme-Mir-279-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila melanogaster) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dme-mir-286 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dme-Mir-279-P2 Dme-Mir-279-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-279-P1a Aae-Mir-279-P1b1 Aae-Mir-279-P1b2 Aga-Mir-279-P1a Aga-Mir-279-P1b Agr-Mir-279 Bko-Mir-279-o1 Bpl-Mir-279 Dan-Mir-279-P1 Dlo-Mir-279-P1 Dma-Mir-279-P1c Dma-Mir-279-P1d Dmo-Mir-279-P1 Dpu-Mir-279-P1c Dpu-Mir-279-P1d Dsi-Mir-279-P1 Dya-Mir-279-P1 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gpa-Mir-279-P1 Gsa-Mir-279 Gsp-Mir-279 Hme-Mir-279-o1 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 Tca-Mir-279-P1c Tca-Mir-279-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Pancrustacea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_melanogaster_BDGP6) |
2R: 19661435-19661509 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-P1) |
Mir-4983
2R: 19637431-19637502 [+]
UCSC
Ensembl
Mir-2-P6c 2R: 19660722-19660787 [-] UCSC Ensembl Mir-2-P6b 2R: 19660874-19660935 [-] UCSC Ensembl Mir-2-P6a 2R: 19661012-19661074 [-] UCSC Ensembl Mir-2-P5 2R: 19661162-19661222 [-] UCSC Ensembl Mir-9-P9 2R: 19661300-19661356 [-] UCSC Ensembl Mir-279-P1 2R: 19661435-19661509 [-] UCSC Ensembl Mir-3-P2 2R: 19661600-19661656 [-] UCSC Ensembl Mir-3-P1 2R: 19661710-19661768 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUAUUGGGCACUCCAGUUUUAAAAUUGAAUGGCGAAUGUCGGUAUGGUCUCUUUUUCAAAGAAAGGUUUCGAUUAAGCGAAGUGACUAGACCGAACACUCGUGCUAUAAUUUUAAAAUAUUCAACAUGCUCAGUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUAUUGGGCACUCCAGU-- AAUG A -| A U UUUUCAAAGAAAG UUUAAAAUUG GCGA UG UCGGU UGGUC CU G AAAUUUUAAU UGCU AC AGCCA AUCAG GA U AUGACUCGUACAACUUAUA AUCG C A^ G U AGCGAAUUAGCUU 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dme-Mir-279-P1_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0020820 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGCGAAUGUCGGUAUGGUCUCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dme-Mir-279-P1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000359 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
52- UGACUAGACCGAACACUCGUGCU -75
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000359 TargetScanFly: dme-miR-286 |






