| MirGeneDB ID | Dsi-Mir-279-P1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-279 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Fruit fly (Drosophila simulans) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | dsi-mir-286 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Dsi-Mir-279-P2 Dsi-Mir-279-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-279-P1a Aae-Mir-279-P1b1 Aae-Mir-279-P1b2 Aga-Mir-279-P1a Aga-Mir-279-P1b Agr-Mir-279 Bko-Mir-279-o1 Bpl-Mir-279 Dan-Mir-279-P1 Dlo-Mir-279-P1 Dma-Mir-279-P1c Dma-Mir-279-P1d Dme-Mir-279-P1 Dmo-Mir-279-P1 Dpu-Mir-279-P1c Dpu-Mir-279-P1d Dya-Mir-279-P1 Eba-Mir-279 Egr-Mir-279 Esc-Mir-279 Gpa-Mir-279-P1 Gsa-Mir-279 Gsp-Mir-279 Hme-Mir-279-o1 Hru-Mir-279 Isc-Mir-279 Lgi-Mir-279 Lhy-Mir-279 Llo-Mir-279 Mgi-Mir-279 Mom-Mir-279 Npo-Mir-279 Obi-Mir-279 Ovu-Mir-279 Pau-Mir-279 Pcr-Mir-279 Pve-Mir-279 Rph-Mir-279 Sma-Mir-279 Sne-Mir-279 Tca-Mir-279-P1c Tca-Mir-279-P1d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Pancrustacea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Drosophila_simulans.ASM75419v3.dna.toplevel) |
2R: 16151283-16151358 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-279-P1) |
Mir-4983
2R: 16127028-16127099 [+]
UCSC
Ensembl
Mir-2-P6c 2R: 16150571-16150636 [-] UCSC Ensembl Mir-2-P6b 2R: 16150723-16150784 [-] UCSC Ensembl Mir-2-P6a 2R: 16150863-16150925 [-] UCSC Ensembl Mir-2-P5 2R: 16151011-16151070 [-] UCSC Ensembl Mir-9-P9 2R: 16151148-16151204 [-] UCSC Ensembl Mir-279-P1 2R: 16151283-16151358 [-] UCSC Ensembl Mir-3-P2 2R: 16151447-16151503 [-] UCSC Ensembl Mir-3-P1 2R: 16151557-16151615 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GACUAGA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUAUUGGGCACUCCAGUUUUAAAAUUGAAUGGCGAAUGUCGGUAUGGUCUCUUUUUCCAAAGAAAGGUUUCGAUCAAGCGAAGUGACUAGACCGAACACUCGUGCUAUAAUUUUAAAAUAUUCAACAUGCUCAGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUAUUGGGCACUCCAGU-- AAUG A -| A U UUUUCCAAAGAAAG UUUAAAAUUG GCGA UG UCGGU UGGUC CU \ AAAUUUUAAU UGCU AC AGCCA AUCAG GA G GUGACUCGUACAACUUAUA AUCG C A^ G U AGCGAACUAGCUUU 130 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Dsi-Mir-279-P1_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGCGAAUGUCGGUAUGGUCUCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Dsi-Mir-279-P1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0008859 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
53- UGACUAGACCGAACACUCGUGCU -76
Get sequence
|






