| MirGeneDB ID | Gsa-Mir-2-o162 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Russian doll killer (Gyrodactylus salaris) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | gsa-mir-2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gsa-Mir-2-o161a Gsa-Mir-2-o161b Gsa-Mir-2-o163 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | G. salaris | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (gyrodactylus_salaris.PRJNA244375.WBPS19.genomic) |
scf7180006951238: 8224-8285 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o162) |
Mir-71-o7
scf7180006951238: 7887-7948 [+]
UCSC
Ensembl
Mir-2-o161a scf7180006951238: 8098-8159 [+] UCSC Ensembl Mir-2-o161b scf7180006951238: 8098-8159 [+] UCSC Ensembl Mir-2-o162 scf7180006951238: 8224-8285 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CCCUUGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAGCAUCUUGCUUAACUGGUGUCUUCAUAAACCCUUGCUCGGGUGUGAUGUGUCUAAUGAUUAAUCAUAUCACAGCCGUGCUUUAAGGGCUUUUGAUGCACCAUAUACUUCAUUAACUGCAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAGCAUCUUGCUUAACU--- CU U A ---| U G UCUAAU GGUGU UCA AA CCCUU GC CGG UGUGAUGUG \ CCACG AGU UU GGGAA CG GCC ACACUAUAC G AACGUCAAUUACUUCAUAUA U- U C UUU^ U G UAAUUA 120 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gsa-Mir-2-o162_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0035298 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- ACCCUUGCUCGGGUGUGAUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Co-mature sequence | Gsa-Mir-2-o162_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0035299 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- UAUCACAGCCGUGCUUUAAGGGCUU -62
Get sequence
|






