| MirGeneDB ID | Lhy-Mir-2-o81 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Laevipilina (Monoplacophora) (Laevipilina hyalina) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lhy-Mir-2-o80 Lhy-Mir-2-o82 Lhy-Mir-2-o83 Lhy-Mir-2-o84 Lhy-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | L. hyalina | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Mono_atcgn_nospaces) |
scaffold155753_41.9: 1524-1583 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o81) |
Mir-2-o84
scaffold155753_41.9: 968-1026 [-]
Ensembl
Mir-2-o83 scaffold155753_41.9: 1118-1176 [-] Ensembl Mir-2-o82 scaffold155753_41.9: 1300-1355 [-] Ensembl Mir-2-o81 scaffold155753_41.9: 1524-1583 [-] Ensembl Mir-2-P12 scaffold155753_41.9: 1702-1759 [-] Ensembl Mir-2-o80 scaffold155753_41.9: 2057-2118 [-] Ensembl Mir-71 scaffold155753_41.9: 2279-2337 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCGAAGCUUUGAAAAUCGUGCGUGCCCACGAUUGUCAAGGUGGCUGUUGAUGUGUUUAAAUUCUCAUAUCACAGCCUGCUUUGAUGAGCUUGGACAUACAUGAACACAGCAAUGCGAAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCGAAGCUUUGAAAAUC-- CG C CGA UG -| U UUUA GUG UG CCA U UCAAGGU GGCUGU GAUGUG A UAC AC GGU A AGUUUCG CCGACA CUAUAC A GAAAGCGUAACGACACAAG AU A UCG GU U^ - UCUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lhy-Mir-2-o81_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUUGUCAAGGUGGCUGUUGAUGUG -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lhy-Mir-2-o81_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UAUCACAGCCUGCUUUGAUGAGCU -60
Get sequence
|






