| MirGeneDB ID | Lhy-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Laevipilina (Monoplacophora) (Laevipilina hyalina) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Lhy-Mir-2-o80 Lhy-Mir-2-o81 Lhy-Mir-2-o82 Lhy-Mir-2-o83 Lhy-Mir-2-o84 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-2-P12a Agr-Mir-2-P12b Agr-Mir-2-P12c Agr-Mir-2-P12d Agr-Mir-2-P12e Agr-Mir-2-P12f1 Agr-Mir-2-P12f2 Cte-Mir-2-P12 Dgr-Mir-2-P12 Efe-Mir-2-P12f Efe-Mir-2-P12g Esc-Mir-2-P12 Gsp-Mir-2 Hru-Mir-2-P12 Lgi-Mir-2-P12a Lgi-Mir-2-P12b Lgi-Mir-2-P12c Lgi-Mir-2-P12d Lgi-Mir-2-P12e Llo-Mir-2-P12 Mgi-Mir-2-P12 Mom-Mir-2-P12f Mom-Mir-2-P12g Mom-Mir-2-P12h Mom-Mir-2-P12i Mom-Mir-2-P12j Mom-Mir-2-P12k Npo-Mir-2-P12 Obi-Mir-2-P12 Ofu-Mir-2-P12 Ovu-Mir-2-P12 Pau-Mir-2-P12 Pdu-Mir-2-P12 Ple-Mir-2 Pve-Mir-2-P12 Rph-Mir-2-P12 War-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Lophotrochozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Mono_atcgn_nospaces) |
scaffold155753_41.9: 1702-1759 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-P12) |
Mir-2-o84
scaffold155753_41.9: 968-1026 [-]
Ensembl
Mir-2-o83 scaffold155753_41.9: 1118-1176 [-] Ensembl Mir-2-o82 scaffold155753_41.9: 1300-1355 [-] Ensembl Mir-2-o81 scaffold155753_41.9: 1524-1583 [-] Ensembl Mir-2-P12 scaffold155753_41.9: 1702-1759 [-] Ensembl Mir-2-o80 scaffold155753_41.9: 2057-2118 [-] Ensembl Mir-71 scaffold155753_41.9: 2279-2337 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UUGCAGCAAUGUCUUUGCCGUCUACAUUGCUGGCCACGUGGCUGUGGUUUGUGAUUUUGCCACCAUAUCACAGCCUGCUUGGAUCAGUAAUGUAUGUUGGUACAACCGUCGGUUUGAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UUGCAGCAAUGUCUUUG- UC- - C -| U UGAUU CCG UACAUUGCUGG CCA GU GGCUGUGGU UG U GGU AUGUAAUGACU GGU CG CCGACACUA AC U AAGUUUGGCUGCCAACAU UGU A U U^ U CACCG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Lhy-Mir-2-P12_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGGCCACGUGGCUGUGGUUUG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Lhy-Mir-2-P12_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- UAUCACAGCCUGCUUGGAUCAGU -58
Get sequence
|






