| MirGeneDB ID | Hru-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Red Abalone (Haliotis rufescens) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Hru-Mir-2-o51 Hru-Mir-2-o52 Hru-Mir-2-o53 Hru-Mir-2-o54 Hru-Mir-2-o55 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Agr-Mir-2-P12a Agr-Mir-2-P12b Agr-Mir-2-P12c Agr-Mir-2-P12d Agr-Mir-2-P12e Agr-Mir-2-P12f1 Agr-Mir-2-P12f2 Cte-Mir-2-P12 Dgr-Mir-2-P12 Efe-Mir-2-P12f Efe-Mir-2-P12g Esc-Mir-2-P12 Gsp-Mir-2 Lgi-Mir-2-P12a Lgi-Mir-2-P12b Lgi-Mir-2-P12c Lgi-Mir-2-P12d Lgi-Mir-2-P12e Lhy-Mir-2-P12 Llo-Mir-2-P12 Mgi-Mir-2-P12 Mom-Mir-2-P12f Mom-Mir-2-P12g Mom-Mir-2-P12h Mom-Mir-2-P12i Mom-Mir-2-P12j Mom-Mir-2-P12k Npo-Mir-2-P12 Obi-Mir-2-P12 Ofu-Mir-2-P12 Ovu-Mir-2-P12 Pau-Mir-2-P12 Pdu-Mir-2-P12 Ple-Mir-2 Pve-Mir-2-P12 Rph-Mir-2-P12 War-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Lophotrochozoa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_023055435.1_xgHalRufe1.0.p_genomic_plus_traces) |
JALGQA010000019.1: 17033706-17033763 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-P12) |
Mir-71
JALGQA010000019.1: 17032907-17032964 [+]
UCSC
Ensembl
Mir-2-o55 JALGQA010000019.1: 17033087-17033148 [+] UCSC Ensembl Mir-2-P12 JALGQA010000019.1: 17033706-17033763 [+] UCSC Ensembl Mir-2-o51 JALGQA010000019.1: 17033823-17033880 [+] UCSC Ensembl Mir-2-o52 JALGQA010000019.1: 17033972-17034029 [+] UCSC Ensembl Mir-2-o53 JALGQA010000019.1: 17034102-17034159 [+] UCSC Ensembl Mir-2-o54 JALGQA010000019.1: 17034273-17034331 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
ACUGACAGAUUCUUCAGAAGUAUGCCACUUCUGACCAGGUGGUUGGGAUGUGUUGUACAAGCCAUAUCACAGCCUGCUUGGAUCAGUAGUGUUGUAUUGGUCGCAGCCAGUUGAAAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 ACUGACAGAUUCUUCAGA-- GC U - -| G UUGU AGUAU CACU CUGA CCAGGU GGUUG GAUGUG A UUAUG GUGA GACU GGUUCG CCGAC CUAUAC C AGAAAGUUGACCGACGCUGG UU U A U^ A CGAA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Hru-Mir-2-P12_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUGACCAGGUGGUUGGGAUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Hru-Mir-2-P12_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
34- UAUCACAGCCUGCUUGGAUCAGUA -58
Get sequence
|






