| MirGeneDB ID | Pab-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sumatran orangutan (Pongo abelii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pab-Mir-130-P2a Pab-Mir-130-P2b Pab-Mir-130-P3b Pab-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P1c Ami-Mir-130-P1c Bta-Mir-130-P1c Cfa-Mir-130-P1c Cja-Mir-130-P1c Cpi-Mir-130-P1c Cpo-Mir-130-P1c Dno-Mir-130-P1c Eca-Mir-130-P1c Ete-Mir-130-P1c Gja-Mir-130-P1c Hsa-Mir-130-P1c Laf-Mir-130-P1c Lch-Mir-130-P1c Mdo-Mir-130-P1c Mml-Mir-130-P1c Mmr-Mir-130-P1c Mmu-Mir-130-P1c Mun-Mir-130-P1c Neu-Mir-130-P1c Oan-Mir-130-P1c Ocu-Mir-130-P1c Pbv-Mir-130-P1c Rno-Mir-130-P1c Sha-Mir-130-P1c Spt-Mir-130-P1c Sto-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_028885655.2_NHGRI_mPonAbe1-v2.0_traces) |
CM054688.2: 17780703-17780764 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGGGCCGGCAUGCCUCUGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGCAAUGUUAAAAGGGCAUUGGCCGUGUAGUGCUACCCAGCGCUGGCUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AGGGCCGGCAUGCCUCU- -| A C UG A GUCUGCA GCUGC UGGCCAG GCUCUUUU ACAUUG CU CU C UGAUG GCCGGUU CGGGAAAA UGUAAC GA GA C GUCGGUCGCGACCCAUCG U^ A U GU C UCACUGU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | The post-transcriptional addition of a terminal 3' uridine is supported by the existence of multiple examples of 3' DcRNA reads that start with the U in human and several other vertebrates. All other taxa are treated accordingly. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pab-Mir-130-P1c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUCUUUUCACAUUGUGCUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pab-Mir-130-P1c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CAGUGCAAUGUUAAAAGGGCAU -62
Get sequence
|
