| MirGeneDB ID | Gja-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-130-P1a Gja-Mir-130-P1b Gja-Mir-130-P2a Gja-Mir-130-P2b Gja-Mir-130-P3a Gja-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P1c Ami-Mir-130-P1c Bta-Mir-130-P1c Cfa-Mir-130-P1c Cja-Mir-130-P1c Cpi-Mir-130-P1c Cpo-Mir-130-P1c Dno-Mir-130-P1c Eca-Mir-130-P1c Ete-Mir-130-P1c Hsa-Mir-130-P1c Laf-Mir-130-P1c Lch-Mir-130-P1c Mdo-Mir-130-P1c Mml-Mir-130-P1c Mmr-Mir-130-P1c Mmu-Mir-130-P1c Mun-Mir-130-P1c Neu-Mir-130-P1c Oan-Mir-130-P1c Ocu-Mir-130-P1c Pab-Mir-130-P1c Pbv-Mir-130-P1c Rno-Mir-130-P1c Sha-Mir-130-P1c Spt-Mir-130-P1c Sto-Mir-130-P1c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015165953.1: 38741-38802 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUGAUACACUGGGCAUGGCUCCUGUCCGAGGCUCUUGCCACAUUGUGCUACUGGCAGGGCCCAGCCCAAGCAGUGCCAUGUCGAAAGGGCAUUGGGUGGGUGGCCACAGCUGCAUGAAAUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CUGAUACACUGGGCAUG- -| UG G GCC U UG A GGCAGGG GCU CC UCCGA GCUCUU ACAU G CU CU C CGG GG GGGUU CGGGAA UGUA C GA GA C UCUAAAGUACGUCGACAC U^ GU A AGC C GU C ACCCGAC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-130-P1c_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GCUCUUGCCACAUUGUGCUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-130-P1c_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CAGUGCCAUGUCGAAAGGGCAU -62
Get sequence
|






