| MirGeneDB ID | Gja-Mir-130-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-130 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-130-P1a Gja-Mir-130-P1b Gja-Mir-130-P1c Gja-Mir-130-P2a Gja-Mir-130-P3a Gja-Mir-130-P4a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-130-P2b Ami-Mir-130-P2b Bta-Mir-130-P2b Cfa-Mir-130-P2b Cja-Mir-130-P2b Cli-Mir-130-P2b Cmi-Mir-130-P2b Cpi-Mir-130-P2b Cpo-Mir-130-P2b Dno-Mir-130-P2b Dre-Mir-130-P2b1 Eca-Mir-130-P2b Ete-Mir-130-P2b Gga-Mir-130-P2b Gmo-Mir-130-P2b1 Hsa-Mir-130-P2b Laf-Mir-130-P2b Lch-Mir-130-P2b Loc-Mir-130-P2b Mal-Mir-130-P2b2 Mdo-Mir-130-P2b Mml-Mir-130-P2b Mmr-Mir-130-P2b Mmu-Mir-130-P2b Mun-Mir-130-P2b Oan-Mir-130-P2b Ocu-Mir-130-P2b Pab-Mir-130-P2b Pbv-Mir-130-P2b Rno-Mir-130-P2b Sha-Mir-130-P2b Spt-Mir-130-P2b Sto-Mir-130-P2b Tgu-Mir-130-P2b Xla-Mir-130-P2b3 Xla-Mir-130-P2b4 Xtr-Mir-130-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015174315.1: 146123-146180 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-130-P2b) |
Mir-130-P1b
NW_015174315.1: 144022-144084 [+]
Mir-130-P2b NW_015174315.1: 146123-146180 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGUGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUCCAGAAGUAUCUCUCUGCUGACGAGCGCUCUGACUUCAUUGCACUACUGUUCCUUCCAGCUAGCAGUGCAAUAGUAUUGUCAAAGCACCUGGAAGCAGAACCUGCAGCAACUCCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUCCAGAAGUAUCUCUC-- GA AGC C UUC---| A GUUCCU UGCU CG GCU UGAC AUUGCACU CU \ ACGA GU CGA ACUG UAACGUGA GA U UCCCUCAACGACGUCCAAG AG CCA A UUAUGA^ C UCGACC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Drosha cut -2 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-130-P2b_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCUGACUUCAUUGCACUACU -20
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-130-P2b_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- CAGUGCAAUAGUAUUGUCAAAGC -58
Get sequence
|






