| MirGeneDB ID | Pbv-Mir-192-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-192 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-215 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-192-P2 Ami-Mir-192-P2 Bta-Mir-192-P2 Cfa-Mir-192-P2 Cja-Mir-192-P2 Cli-Mir-192-P2 Cmi-Mir-192-P2 Cpi-Mir-192-P2 Cpo-Mir-192-P2 Dno-Mir-192-P2 Eca-Mir-192-P2 Ete-Mir-192-P2 Gga-Mir-192-P2 Gja-Mir-192-P2 Hsa-Mir-192-P2 Laf-Mir-192-P2 Lch-Mir-192-P2 Mdo-Mir-192-P2 Mml-Mir-192-P2 Mmr-Mir-192-P2 Mmu-Mir-192-P2 Mun-Mir-192-P2 Oan-Mir-192-P2 Oan-Mir-192-P2-as Ocu-Mir-192-P2 Pab-Mir-192-P2 Rno-Mir-192-P2 Spt-Mir-192-P2 Sto-Mir-192-P2 Tgu-Mir-192-P2 Xla-Mir-192-P2a Xla-Mir-192-P2b Xtr-Mir-192-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE955471.1: 57775-57835 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-192-P2) |
Mir-194-P2
KE955471.1: 57464-57519 [+]
Mir-192-P2 KE955471.1: 57775-57835 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGACCUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAUUUCCACCCUGAAAUGAGGUCCAGGGUAAUGACCUAUGAUUUGACAGACUGUGCUAUGUAAGUCUGCCUGUCAUUUCUGUAGGCCAAUACUCUGCAUAUCUUCACUACUCUUCAAGGAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CAUUUCCACCCUGAAAU-- G C A A -| UU ACUGUGCUA GA GU CAGGGUA UG CCUAU GA UGACAG U CU UA GUCUCAU AC GGAUG CU ACUGUC G AAGGAACUUCUCAUCACUU A C A C U^ UU CGUCUGAAU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-192-P2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039020 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUGACCUAUGAUUUGACAGACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-192-P2_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0039021 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- CCUGUCAUUUCUGUAGGCCAAUA -61
Get sequence
|






