| MirGeneDB ID | Sto-Mir-192-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-192 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-192-P2 Ami-Mir-192-P2 Bta-Mir-192-P2 Cfa-Mir-192-P2 Cja-Mir-192-P2 Cli-Mir-192-P2 Cmi-Mir-192-P2 Cpi-Mir-192-P2 Cpo-Mir-192-P2 Dno-Mir-192-P2 Eca-Mir-192-P2 Ete-Mir-192-P2 Gga-Mir-192-P2 Gja-Mir-192-P2 Hsa-Mir-192-P2 Laf-Mir-192-P2 Lch-Mir-192-P2 Mdo-Mir-192-P2 Mml-Mir-192-P2 Mmr-Mir-192-P2 Mmu-Mir-192-P2 Mun-Mir-192-P2 Oan-Mir-192-P2 Oan-Mir-192-P2-as Ocu-Mir-192-P2 Pab-Mir-192-P2 Pbv-Mir-192-P2 Rno-Mir-192-P2 Spt-Mir-192-P2 Tgu-Mir-192-P2 Xla-Mir-192-P2a Xla-Mir-192-P2b Xtr-Mir-192-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01002633.1: 139138-139199 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-192-P2) |
Mir-192-P2
BFAA01002633.1: 139138-139199 [-]
Mir-194-P2 BFAA01002633.1: 139313-139368 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGACCUA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUUUUAAUUAAGGUAAAGGUGUACAGGACAAUGACCUAUGAAUUGACAGCCAGUGCAAUUACAGAUUUGCCUGUCAGUUCCAUAGGCCACUAUUUUGUUCACCACAAUAUUGCAAAAAGUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUUUUAAUUAAGGUAAA-- U CAA A -| C GUGCAAU GGUG ACAGGA UG CCUAU GAAUUGACAG CA \ CCAC UGUUUU AC GGAUA CUUGACUGUC GU U CUUGAAAAACGUUAUAACA U AUC C C^ C UUAGACA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on the 3p arm. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-192-P2_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AUGACCUAUGAAUUGACAGCCA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-192-P2_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- CCUGUCAGUUCCAUAGGCCACUA -62
Get sequence
|






