| MirGeneDB ID | Sto-Mir-144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-144 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-144-v1 Ami-Mir-144 Bta-Mir-144-v1 Cfa-Mir-144-v1 Cja-Mir-144-v1 Cli-Mir-144-v1 Cmi-Mir-144 Cpi-Mir-144 Cpo-Mir-144-v1 Dno-Mir-144 Dre-Mir-144-v1 Ebu-Mir-144-v1 Eca-Mir-144-v1 Ete-Mir-144 Gga-Mir-144 Gja-Mir-144-v1 Gmo-Mir-144-v1 Hsa-Mir-144-v1 Laf-Mir-144 Lch-Mir-144 Loc-Mir-144-v1 Mal-Mir-144-v1 Mdo-Mir-144 Mml-Mir-144 Mmr-Mir-144 Mmu-Mir-144-v1 Mun-Mir-144-v1 Neu-Mir-144-v1 Oan-Mir-144 Ocu-Mir-144-v1 Pab-Mir-144-v1 Pbv-Mir-144 Pma-Mir-144 Rno-Mir-144-v1 Sha-Mir-144 Spt-Mir-144 Tgu-Mir-144-v1 Tni-Mir-144 Xla-Mir-144-P1-v1 Xla-Mir-144-P2-v1 Xtr-Mir-144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01023372.1: 8747-8805 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-144) |
Mir-144
BFAA01023372.1: 8747-8805 [+]
Mir-451 BFAA01023372.1: 9289-9330 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAUAUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGAAUGAAGAGCUGCCUUUGGCUCUGGCUAGGAUAUCAUCAUAUACUGUAAGUUCACUAUUAAUGUACUACAGUAUAGAUGAUGUACUAUUCAGUGCUCGCUUACAUAACCAACACAAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AGAAUGAAGAGCUGCCUUU--| U GC G A A UCACUA GGC CUG UAG AUAUCAUC UAUACUGUA GU \ UCG GAC AUC UGUAGUAG AUAUGACAU CA U GAACACAACCAAUACAUUCGC^ U UU A - - UGUAAU 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms that corresponds to the isomirs in other taxa where the 3p arm is highly expressed. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-144_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGAUAUCAUCAUAUACUGUAAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-144_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- CUACAGUAUAGAUGAUGUACUA -59
Get sequence
|






