| MirGeneDB ID | War-Mir-2-o94 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Wirenia (Solenogaster) (Wirenia argentea) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | War-Mir-2-o93 War-Mir-2-o95 War-Mir-2-o96 War-Mir-2-o97 War-Mir-2-o98 War-Mir-2-o99 War-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | W. argentea | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_025802215.1_ASM2580221v1_Wirenia) |
WNLI01003363.1: 16422-16484 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o94) |
Mir-71
WNLI01003363.1: 14091-14149 [+]
Ensembl
Mir-2-o93 WNLI01003363.1: 15447-15507 [+] Ensembl Mir-2-P12 WNLI01003363.1: 16105-16164 [+] Ensembl Mir-2-o94 WNLI01003363.1: 16422-16484 [+] Ensembl Mir-2-o95 WNLI01003363.1: 17073-17130 [+] Ensembl Mir-2-o96 WNLI01003363.1: 17457-17517 [+] Ensembl Mir-2-o97 WNLI01003363.1: 17735-17794 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGUAGAUGACAUUAUGAGCAAAUUCUGGAGCUCGUCAAAGCCUCUGUGAAAUGUUAUUGGUUGAUGUCAUAUCACAGUUAGCUUUGAUGAACCUCAAUUUUGCAUUGGCAACAGUGACUCUCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AGUAGAUGACAUUAUGA---| UUCUG C- CU- A UUAUUG GCAAA GAG UCGUCAAAGC CUGUGA AUG G CGUUU CUC AGUAGUUUCG GACACU UAC U CCUCUCAGUGACAACGGUUA^ UAA-- CA AUU A UGUAGU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | War-Mir-2-o94_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CUCGUCAAAGCCUCUGUGAAAUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | War-Mir-2-o94_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- UAUCACAGUUAGCUUUGAUGAACC -63
Get sequence
|






