| MirGeneDB ID | Xtr-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-451 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Tropical clawed frog (Xenopus tropicalis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | xtr-mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-451 Ami-Mir-451 Bta-Mir-451 Cfa-Mir-451 Cja-Mir-451 Cli-Mir-451 Cmi-Mir-451 Cpi-Mir-451 Cpo-Mir-451 Dno-Mir-451 Dre-Mir-451 Ebu-Mir-451 Eca-Mir-451 Ete-Mir-451 Gga-Mir-451 Gja-Mir-451 Gmo-Mir-451 Hsa-Mir-451 Laf-Mir-451 Lch-Mir-451 Loc-Mir-451 Mal-Mir-451 Mdo-Mir-451 Mml-Mir-451 Mmr-Mir-451 Mmu-Mir-451 Mun-Mir-451 Neu-Mir-451 Oan-Mir-451 Ocu-Mir-451 Pab-Mir-451 Pma-Mir-451 Rno-Mir-451 Sha-Mir-451 Spt-Mir-451 Sto-Mir-451 Tgu-Mir-451 Tni-Mir-451 Xla-Mir-451-P1 Xla-Mir-451-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (xenTro9_add) |
chr2: 26507261-26507302 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-451) |
Mir-144
chr2: 26506546-26506603 [+]
UCSC
Ensembl
Mir-451 chr2: 26507261-26507302 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AACCGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CUUUGGCAGGAUACCUGUAGAGUGGCAAUGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAGGGUUCUGUUGCUGCUCUUCCAUUCGCCAUUGAGAUUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CUUUGGCAGGAUACCUGU--| UG GA G A AGAG GCAAU AACC UUACCAUUACUG G UCUC CGUUG UUGG AAUGGUAAUGAU U CUUAGAGUUACCGCUUACCU^ GU UC G U 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 4, Kim et al. 2016) miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | NA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Xtr-Mir-451_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0003705 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAACCGUUACCAUUACUGAGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
TargetScanVert: xtr-miR-451 |






