| MirGeneDB ID | Pab-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-451 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Sumatran orangutan (Pongo abelii) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-451 Ami-Mir-451 Bta-Mir-451 Cfa-Mir-451 Cja-Mir-451 Cli-Mir-451 Cmi-Mir-451 Cpi-Mir-451 Cpo-Mir-451 Dno-Mir-451 Dre-Mir-451 Ebu-Mir-451 Eca-Mir-451 Ete-Mir-451 Gga-Mir-451 Gja-Mir-451 Gmo-Mir-451 Hsa-Mir-451 Laf-Mir-451 Lch-Mir-451 Loc-Mir-451 Mal-Mir-451 Mdo-Mir-451 Mml-Mir-451 Mmr-Mir-451 Mmu-Mir-451 Mun-Mir-451 Neu-Mir-451 Oan-Mir-451 Ocu-Mir-451 Pma-Mir-451 Rno-Mir-451 Sha-Mir-451 Spt-Mir-451 Sto-Mir-451 Tgu-Mir-451 Tni-Mir-451 Xla-Mir-451-P1 Xla-Mir-451-P2 Xtr-Mir-451 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_028885655.2_NHGRI_mPonAbe1-v2.0_traces) |
CM054698.2: 42959523-42959564 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-451) |
Mir-451
CM054698.2: 42959523-42959564 [-]
UCSC
Ensembl
Mir-144-v1 CM054698.2: 42959687-42959744 [-] UCSC Ensembl Mir-144-v2 CM054698.2: 42959687-42959744 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AACCGUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGACUGCCAGGGCACUUGGGAAUGGCAAGGAAACCGUUACCAUUACUGAGUUUAGUAAUGGUAAUGGUUCUCUUGCUAUACCCAGAAAACGUGCCAGGAAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGACUGCCAGGGCACUU--| A GA A GGG AUGGCAAG AACCGUUACCAUUACUG G CCC UAUCGUUC UUGGUAAUGGUAAUGAU U AGAAGGACCGUGCAAAAGA^ A UC U 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | As a non-canonical (Group 4, Kim et al. 2016) miRNA there is no discrete 3p read and the 3' end of the mature miRNA is somewhat arbitrary. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | NA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pab-Mir-451_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AAACCGUUACCAUUACUGAGUU -22
Get sequence
|






