| MirGeneDB ID | Cli-Mir-599 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-599 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Rock pigeon (Columba livia) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | cli-mir-599 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-599 Bta-Mir-599 Cfa-Mir-599 Cja-Mir-599 Cpi-Mir-599 Eca-Mir-599 Ete-Mir-599 Hsa-Mir-599 Laf-Mir-599 Lch-Mir-599 Mdo-Mir-599 Mml-Mir-599 Mmr-Mir-599 Mmu-Mir-599 Mun-Mir-599 Neu-Mir-599 Oan-Mir-599 Ocu-Mir-599 Pab-Mir-599 Pbv-Mir-599 Sha-Mir-599 Spt-Mir-599 Tgu-Mir-599 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Sarcopterygii | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Sarcopterygii | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (colLiv2) |
scaffold1: 1574686-1574745 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-599) |
Mir-875
scaffold1: 1574523-1574579 [+]
Mir-599 scaffold1: 1574686-1574745 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGUGUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCAAGUAGCAGACAGACUGUCCACAGUGUGUUUGAUAAGCUGACAUGGGACAGGAUUUCUUUUCACUGUUGUGUCAGUAUAUCAAACUCAUACCUGGUCAUCAGUCAAAUUCUAUACAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CCAAGUAGCAGACAGAC--- U CA-| U A GG AGGAUUU UG CCA GUG GUUUGAUA GCUGACAU GAC C AC GGU UAC CAAACUAU UGACUGUG UUG U AGACAUAUCUUAAACUGACU U CCA^ U A -- UCACUUU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | This miRNA is likely mono-adenylated at the 3' end given the offset in addition to phylogenetic considerations despite the templated adenosine. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cli-Mir-599_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UUUGAUAAGCUGACAUGGGAC -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cli-Mir-599_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038666 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UUGUGUCAGUAUAUCAAACUCA -60
Get sequence
|






