| MirGeneDB ID | Gja-Mir-15-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-15 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-15-P1a Gja-Mir-15-P1b Gja-Mir-15-P1c Gja-Mir-15-P2b Gja-Mir-15-P2c Gja-Mir-15-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-15-P2a Bta-Mir-15-P2a Cfa-Mir-15-P2a Cin-Mir-15-P2 Cja-Mir-15-P2a Cli-Mir-15-P2a Cmi-Mir-15-P2a Cpi-Mir-15-P2a Cpo-Mir-15-P2a Dno-Mir-15-P2a Dre-Mir-15-P2a1 Dre-Mir-15-P2a2 Eca-Mir-15-P2a Ete-Mir-15-P2a Gga-Mir-15-P2a Gmo-Mir-15-P2a2 Hsa-Mir-15-P2a Laf-Mir-15-P2a Lch-Mir-15-P2a Loc-Mir-15-P2a Mal-Mir-15-P2a2 Mdo-Mir-15-P2a Mml-Mir-15-P2a Mmr-Mir-15-P2a Mmu-Mir-15-P2a Mun-Mir-15-P2a Neu-Mir-15-P2a Oan-Mir-15-P2a Ocu-Mir-15-P2a Pab-Mir-15-P2a Pbv-Mir-15-P2a Rno-Mir-15-P2a Sha-Mir-15-P2a Spt-Mir-15-P2a Sto-Mir-15-P2a Tgu-Mir-15-P2a Tni-Mir-15-P2a2 Xla-Mir-15-P2a3 Xla-Mir-15-P2a4 Xtr-Mir-15-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Olfactores | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015176538.1: 29243-29308 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-15-P2a) |
Mir-15-P2a
NW_015176538.1: 29243-29308 [-]
Mir-15-P1a NW_015176538.1: 29392-29450 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AGCAGCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGGCAUAGGUUCCUGGUGUCAGCUGUGCCCUAGCAGCACAAAAAUAUUGGGAGUUAUUCUUAGUCAAGUGCCUCCAAUAUUGACUGUGCUGCUGAAGUAAGGCUGAUUAUUCUUCCACAAGUCUCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UGGCAUAGGUUCCUGGU-- G CC AA-| AGUUAUUCUU GUCAGCU UGC UAGCAGCACA AAUAUUGGG \ UAGUCGG AUG GUCGUCGUGU UUAUAACCU A UCUCUGAACACCUUCUUAU A AA CAG^ CCGUGAACUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a 1 nt insertion in the Gekko japonica genome sequence relative to the Coleonyx read data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-15-P2a_5p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UAGCAGCACAAAAAUAUUGGGAG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-15-P2a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- UCCAAUAUUGACUGUGCUGCUGAA -66
Get sequence
|






