| MirGeneDB ID | Gja-Mir-30-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-30 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Schlegels Japanese gecko (Gekko japonicus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Gja-Mir-30-P1b Gja-Mir-30-P1d Gja-Mir-30-P2a Gja-Mir-30-P2b Gja-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-30-P1a Ami-Mir-30-P1a Bta-Mir-30-P1a Cfa-Mir-30-P1a Cja-Mir-30-P1a Cli-Mir-30-P1a Cmi-Mir-30-P1a Cpi-Mir-30-P1a Cpo-Mir-30-P1a Dno-Mir-30-P1a Dre-Mir-30-P1a Eca-Mir-30-P1a Ete-Mir-30-P1a Gga-Mir-30-P1a Gmo-Mir-30-P1a Hsa-Mir-30-P1a Laf-Mir-30-P1a Lch-Mir-30-P1a Loc-Mir-30-P1a Mal-Mir-30-P1a Mdo-Mir-30-P1a Mml-Mir-30-P1a Mmr-Mir-30-P1a Mmu-Mir-30-P1a Mun-Mir-30-P1a Neu-Mir-30-P1a Oan-Mir-30-P1a Ocu-Mir-30-P1a Pab-Mir-30-P1a Pbv-Mir-30-P1a Rno-Mir-30-P1a Sha-Mir-30-P1a Spt-Mir-30-P1a Sto-Mir-30-P1a Tgu-Mir-30-P1a Tni-Mir-30-P1a Xla-Mir-30-P1a1 Xla-Mir-30-P1a2 Xtr-Mir-30-P1a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_001447785.1_Gekko_japonicus) |
NW_015176490.1: 310743-310799 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-30-P1a) |
Mir-30-P2a
NW_015176490.1: 308088-308147 [-]
Mir-30-P1a NW_015176490.1: 310743-310799 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUAAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UCUCGUUCCAGAUGCACGGUAGUCUGUAGUUGUAAACAUCCCCGACUGGAAGCUGGAAACCGUAGCUUUCAGUCAGAUGUUUGCUGCCACCGGCUAUUAAUAAACAACACUGGAAGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UCUCGUUCCAGAUGCAC--| U A U CCC GGAA GGUAGUC GU GU GUAAACAUC GACUGGAAGCU \ UUAUCGG CA CG CGUUUGUAG CUGACUUUCGA A AGAAGGUCACAACAAAUAA^ C C U A-- UGCC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut -1 on both arms. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Gja-Mir-30-P1a_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUAAACAUCCCCGACUGGAAGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Gja-Mir-30-P1a_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
35- CUUUCAGUCAGAUGUUUGCUGC -57
Get sequence
|






