| MirGeneDB ID | Mal-Mir-459 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-459 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Asian swamp eel (Monopterus albus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Ami-Mir-459 Bta-Mir-459 Cfa-Mir-459 Cja-Mir-459 Cli-Mir-459 Cpi-Mir-459 Cpo-Mir-459 Dno-Mir-459 Dre-Mir-459 Ebu-Mir-459 Eca-Mir-459 Ete-Mir-459 Gmo-Mir-459 Hsa-Mir-459 Laf-Mir-459 Loc-Mir-459 Mml-Mir-459 Mmr-Mir-459 Mmu-Mir-459 Mun-Mir-459 Oan-Mir-459 Ocu-Mir-459 Pab-Mir-459 Pma-Mir-459 Rno-Mir-459 Spt-Mir-459 Sto-Mir-459 Tni-Mir-459 Xla-Mir-459-P1 Xla-Mir-459-P2 Xtr-Mir-459 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_001952655.1_M_albus_1.0_genomic) |
KV885129.1: 174998-175060 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CAGUAAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUUACUGUAUUUGACAGUGAUGUGGCGCUUUCAGUAACAAGGAUUCAUCCUGUUGUGGUGCUGUAGGCUGACAGGAAAUCACUGUUACUGGGGGCGAGUGUCACUUGAACACAUGUUUAUUGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUUACUGUAUUUGACAG---| UG GG UU AG CA UGUGGUGC UGA U CGCU CAGUAACA GAUU UCCUGU \ ACU G GCGG GUCAUUGU CUAA AGGACA U AGUUAUUUGUACACAAGUUC^ GU A- GG CA -- GUCGGAUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mal-Mir-459_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCAGUAACAAGGAUUCAUCCUGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mal-Mir-459_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- AGGAAAUCACUGUUACUGGGG -63
Get sequence
|






