| MirGeneDB ID | Mmu-Mir-328 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-328 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | House mouse (Mus musculus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | mmu-mir-328 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Bta-Mir-328 Cfa-Mir-328 Cja-Mir-328 Cpo-Mir-328 Dno-Mir-328 Eca-Mir-328 Ete-Mir-328 Hsa-Mir-328 Laf-Mir-328 Mml-Mir-328 Mmr-Mir-328 Ocu-Mir-328 Pab-Mir-328 Rno-Mir-328 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (mm10) |
chr8: 105308380-105308440 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UGGCCCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AAGUCCUGGGCUGUCUCGGAGCCUGGGGCAGGGGGGCAGGAGGGGCUCAGGGAGAAAGUAUCUACAGCCCCUGGCCCUCUCUGCCCUUCCGUCCCCUGUCCCCAAGUACACUGGACCCAGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AAGUCCUGGGCUGUCUC--| AG CU A GA U AGAAAGU GG C GGGGC GGGGGGCAG GGGGC CAGGG A CC G CCCUG CUUCCCGUC UCCCG GUCCC U CGACCCAGGUCACAUGAAC^ CU UC C UC - CGACAUC . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | Although there is a templated T at the 3' end of the 3p arm, the post-transcriptional addition of a terminal 3' U is supported by the 3' offset reads in cow in addition to the 3p reads in armadillo where the T is not templated. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Mmu-Mir-328_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0017030 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGGGGCAGGAGGGGCUCAGGG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
TargetScanVert: mmu-miR-328-5p miRDB: MIMAT0017030 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Mmu-Mir-328_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0000565 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CUGGCCCUCUCUGCCCUUCCG -61
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Proposed targets |
microrna.org: MIMAT0000565 TargetScanVert: mmu-miR-328-3p miRDB: MIMAT0000565 |






