| MirGeneDB ID | Pbv-Mir-23-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-23 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-23b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-23-P3 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-23-P2 Ami-Mir-23-P2 Bta-Mir-23-P2 Cfa-Mir-23-P2 Cja-Mir-23-P2 Cli-Mir-23-P2 Cmi-Mir-23-P2 Cpi-Mir-23-P2 Cpo-Mir-23-P2 Dno-Mir-23-P2 Dre-Mir-23-P2a Dre-Mir-23-P2b Eca-Mir-23-P2 Ete-Mir-23-P2 Gga-Mir-23-P2 Gja-Mir-23-P2 Gmo-Mir-23-P2b Hsa-Mir-23-P2 Laf-Mir-23-P2 Lch-Mir-23-P2 Loc-Mir-23-P2 Mal-Mir-23-P2a Mal-Mir-23-P2b Mdo-Mir-23-P2 Mml-Mir-23-P2 Mmr-Mir-23-P2 Mmu-Mir-23-P2 Mun-Mir-23-P2 Neu-Mir-23-P2 Oan-Mir-23-P2 Ocu-Mir-23-P2 Pab-Mir-23-P2 Pma-Mir-23-o2 Rno-Mir-23-P2 Sha-Mir-23-P2 Spt-Mir-23-P2 Sto-Mir-23-P2 Tgu-Mir-23-P2 Tni-Mir-23-P2b Xla-Mir-23-P2c Xla-Mir-23-P2d Xtr-Mir-23-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE954626.1: 204684-204743 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-23-P2) |
Mir-23-P2
KE954626.1: 204684-204743 [+]
Mir-27-P2 KE954626.1: 204891-204953 [+] Mir-24-P2 KE954626.1: 205436-205495 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCACAUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUACAGAUUUCAUUCCUGUUUUGGUUGUUUGGGUUCCUGGCAUGCUGAUUUGUGAUUUAAGAUUAAAAUCACAUUGCCAGGGAUUACCACAUAACCAUGACAUUACCUUCUAUGGCUUAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUACAGAUUUCAUUCCU-- U U -- -| C GUGAUU GUU UGGUUGU UGG GUUCCUGGC AUG UGAUUU U CAG ACCAAUA ACC UAGGGACCG UAC ACUAAA A AAUUCGGUAUCUUCCAUUA U C AU U^ - AUUAGA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-23-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038854 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGUUCCUGGCAUGCUGAUUU -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-23-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038855 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence
|
