| MirGeneDB ID | Sto-Mir-23-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-23 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Cloudy Catshark (Scyliorhinus torazame) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Sto-Mir-23-P1 Sto-Mir-23-P3 Sto-Mir-23-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-23-P2 Ami-Mir-23-P2 Bta-Mir-23-P2 Cfa-Mir-23-P2 Cja-Mir-23-P2 Cli-Mir-23-P2 Cmi-Mir-23-P2 Cpi-Mir-23-P2 Cpo-Mir-23-P2 Dno-Mir-23-P2 Dre-Mir-23-P2a Dre-Mir-23-P2b Eca-Mir-23-P2 Ete-Mir-23-P2 Gga-Mir-23-P2 Gja-Mir-23-P2 Gmo-Mir-23-P2b Hsa-Mir-23-P2 Laf-Mir-23-P2 Lch-Mir-23-P2 Loc-Mir-23-P2 Mal-Mir-23-P2a Mal-Mir-23-P2b Mdo-Mir-23-P2 Mml-Mir-23-P2 Mmr-Mir-23-P2 Mmu-Mir-23-P2 Mun-Mir-23-P2 Neu-Mir-23-P2 Oan-Mir-23-P2 Ocu-Mir-23-P2 Pab-Mir-23-P2 Pbv-Mir-23-P2 Pma-Mir-23-o2 Rno-Mir-23-P2 Sha-Mir-23-P2 Spt-Mir-23-P2 Tgu-Mir-23-P2 Tni-Mir-23-P2b Xla-Mir-23-P2c Xla-Mir-23-P2d Xtr-Mir-23-P2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_003427355_STO_add) |
BFAA01002700.1: 246394-246453 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-23-P2) |
Mir-24-P2
BFAA01002700.1: 238946-239005 [-]
Mir-27-P2 BFAA01002700.1: 246153-246216 [-] Mir-23-P2 BFAA01002700.1: 246394-246453 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | UCACAUU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGCAAAUUUCCUUUCAUGUUGUGGCCGAGUGGGUUCCUGGCAUACUGAUUUGUGACAUGAGAUAAAAAUCACAUUGCCAGGGAUUACCACAUAGUCACUGCCUUGACUGCUGUUCUGGAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 UGCAAAUUUCCUUUCAU-- U CGA --| UAC GUGACA GU GUGGC GUGG GUUCCUGGCA UGAUUU U CG CACUG CACC UAGGGACCGU ACUAAA G AAGGUCUUGUCGUCAGUUC U AUA AU^ UAC AAUAGA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Sto-Mir-23-P2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGGUUCCUGGCAUACUGAUUU -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Sto-Mir-23-P2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
37- AUCACAUUGCCAGGGAUUACCAC -60
Get sequence
|
